answersLogoWhite

0

In the cases of MRNA and DNA there are differences in the base pairs that make up the two compounds. In a situation in which Adenosine, Thymine, and Cytosine would need to be paired between DNA and RNA Guanine would be used on the RNA side.

User Avatar

Wiki User

12y ago

What else can I help you with?

Related Questions

What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is complementary sequence?

When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.


List the two nucleotide sequence that are complementary to the sticky end sequence on the human DNA?

The complementary nucleotide sequence to a sticky end sequence on human DNA would be its reverse complement sequence. For example, if the sticky end sequence is "AATT", its complementary sequence would be "TTAA".


What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?

The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


What is the complementary base sequence of DNA strand?

TGCA


What is the enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence?

DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.


What is the complementary DNA for TAC GG?

The complementary strand of this DNA sequence is... A T G C T A A C C


What is the dna segment of ugauuc from mRNA?

The DNA segment complementary to the mRNA sequence "UGAUUC" would be "ACTAAG". This is because in DNA, adenine pairs with thymine and cytosine pairs with guanine. Thus, the complementary DNA sequence of the mRNA sequence is determined by replacing each base with its complementary base.


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.