answersLogoWhite

0

The molecular sequence that serves as the blueprint for a protein is the sequence of nucleotides in a gene, encoded in DNA. This sequence is transcribed into messenger RNA (mRNA), which carries the genetic information from the nucleus to the ribosomes. There, the mRNA sequence is translated into a specific sequence of amino acids, forming a protein. The order of nucleotides ultimately determines the structure and function of the protein.

User Avatar

AnswerBot

4mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What is a term that means blueprint for one protein?

The term that refers to a blueprint for one protein is "gene." A gene is a specific sequence of DNA that contains the instructions for synthesizing a particular protein, dictating its amino acid sequence and ultimately determining its structure and function within the cell.


Which of these originally tells where an amino acid is to be positioned in a protein?

The sequence of nucleotides in messenger RNA (mRNA) primarily determines the positioning of amino acids in a protein. This sequence is transcribed from DNA and translated by ribosomes during protein synthesis, where each set of three nucleotides, known as a codon, corresponds to a specific amino acid. Thus, the mRNA sequence serves as the blueprint for assembling the amino acids in the correct order to form a protein.


What sequence best represents the relationship between DNA and the traits of an organism?

DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.


What are the molecular units of protein molecules?

Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.


What organelle can be described as the blueprint to the creation of a protein?

The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.

Related Questions

What is a term that means blueprint for one protein?

The term that refers to a blueprint for one protein is "gene." A gene is a specific sequence of DNA that contains the instructions for synthesizing a particular protein, dictating its amino acid sequence and ultimately determining its structure and function within the cell.


What Reads the blueprint and brings and inserts correct amino acid in making a protein sequence?

tRNA (transfer ribose nucleic acid.)


Which type of RNA is called the blueprint for construction of a protein?

Messenger RNA (mRNA) is the type of RNA that carries the genetic information from the DNA in the cell's nucleus to the ribosomes in the cytoplasm, where protein synthesis occurs. It is often referred to as the blueprint for constructing a protein because it carries the instructions for the sequence of amino acids that make up the protein.


Which of these originally tells where an amino acid is to be positioned in a protein?

The sequence of nucleotides in messenger RNA (mRNA) primarily determines the positioning of amino acids in a protein. This sequence is transcribed from DNA and translated by ribosomes during protein synthesis, where each set of three nucleotides, known as a codon, corresponds to a specific amino acid. Thus, the mRNA sequence serves as the blueprint for assembling the amino acids in the correct order to form a protein.


What sequence best represents the relationship between DNA and the traits of an organism?

DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.


What are the molecular units of protein molecules?

Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.


What you would find in a gene?

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).


How do you calculate molecular weight of protein from blood?

To calculate the molecular weight of a protein from blood, you typically use techniques like size-exclusion chromatography or SDS-PAGE to separate the proteins based on size. After separation, you can compare the migration distance of the protein of interest with standard proteins of known molecular weights. Additionally, you can use the protein's amino acid sequence, where the molecular weight is calculated by summing the average molecular weights of the individual amino acids and accounting for water molecules released during peptide bond formation. The final molecular weight can be expressed in Daltons (Da).


What organelle can be described as the blueprint to the creation of a protein?

The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.


What is the role of DNA molecules in the synthesis of proteins?

DNA molecules serve as the genetic blueprint that contains the instructions for synthesizing proteins. The process begins with the DNA in the nucleus being transcribed into messenger RNA (mRNA). This mRNA then travels to the ribosomes in the cytoplasm where it is translated into a specific sequence of amino acids, which ultimately leads to the synthesis of proteins.


DNA is used as a blueprint to make this molecule?

In the process of transcription, DNA is used as a blueprint to make m-RNA which codes for a specific protein.


What has the author Dongsheng Wang written?

Dongsheng Wang has written: 'Molecular cloning and nucleotide sequence of a Streptococcus mutans gene encoding biotin carboxyl carrier protein'