answersLogoWhite

0

In a eukaryotic cell( multi celled/ uni celled), you would find DNA in the nucleus. In a prokaryotic cell( only unicellular) you would find it in the cytoplasm.

User Avatar

Wiki User

13y ago

What else can I help you with?

Related Questions

What strand of DNA would be prod from the template strand of DNA shown below?

The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.


DNA strand that would replicate tcgagaatctcgatt?

The complimentary DNA strand would be AGCTCTTAGAGCTAA.


What strand of DNA would be would be produced from the template strand of DNA shown?

Ttg ga


When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?

TAGC.


What complementary strand of DNA would be produced from the DNA strand cgt ta?

The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.


If you were to stretch the DNA from a cell out, how long would the strand be?

If you were to stretch the DNA from a cell out, the strand would be about 6 feet long.


Which strand would be the template for the leading strand?

The leading strand would utilize the 3' to 5' template DNA strand as a guide for continuous synthesis of complementary DNA in the 5' to 3' direction by DNA polymerase during DNA replication.


What would match the DNA strand TCCGAACGTC?

The complementary DNA strand to TCCGAACGTC is AGGCTTGCAA. This is because adenine pairs with thymine and cytosine pairs with guanine in DNA.


What strand of DNA of would be produced from the template strand of DNA?

AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.


If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?

The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.


The complimentary strand or matchig strand of DNA for tagtca would be?

It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.


What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

To determine the DNA replication strand for the sequence ATGCATTGACGGTACCGATACATCAT, you need to find the complementary bases. The complementary strand would be TACGTAACCTGCCATGGCTATGTAGTA, where adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).