answersLogoWhite

0


Best Answer

Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's.

Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'.

However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu.

I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.

User Avatar

Wiki User

11y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

12y ago

if you gave me the dna sequence in the question this would be easier to answer

This answer is:
User Avatar

User Avatar

Wiki User

11y ago

CGACGAGTGTAGGGCAA

This answer is:
User Avatar

User Avatar

Anonymous

Lvl 1
4y ago

T A C G G G A C A T A G

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: How would the following base sequence be coded for in mrna cag tgc acg?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What is each one?

Each chromosome has genes on it in the form of coded base nucleotide sequence which is part of DNA.


The information of DNA is actually coded in the sequence of nitrogen containing what?

The information of DNA is actually coded in the sequence of nitrogen containing bases. These bases are named adenine, cytosine, guanine or thymine, (A, C, G, T).


During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?

ji


If a strand of DNA were composed of the base sequence ATCG what would be the sequence of it opposing base pairs?

TAGC


What gene DNA sequence encodes mvhtdaekaavsglw?

None, all DNA sequences are coded for by just four base pairs, AT, TA. GC and CG.


What Is part of the DNA code on a chromosome?

Each chromosome has genes on it in the form of coded base nucleotide sequence which is part of DNA.


If the base sequence of template strand is GCCATTAC what would the base sequence of the mRNA?

The mRNA will have codons AUG-CCA-GUA-GGC-CAC


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What sequence of bases would you expect to see paired with a segment of DNA with base sequence acgtcg?

In DNA, the sequence of bases that would pair with GTACG would be CATGC. In RNA, the sequence of bases that would pair with GTACG would be CAUGC, because in RNA, uracil (U) replaces thymine (T).


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


What would be the first three amino acids in the protein formed from this gene uagcgagg?

Each amino acid is coded for by a 3-base sequence known as a codon. Therefore you would need 9 bases to code for 3 amino acids.The sequence UAG-CGA-GG would not add three amino acids to a protein.For the sequence UAG-CGA-GG:UAG is a STOP codon - translation would cease at this point and no further amino acids would be added.CGA codes for Arginine.GG does not code for an amino acid - it would need one more base to be a codon. GGU, GGA, GGG and GGC all code for Glycine.


A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?

RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU