In DNA, complementary strands are two strands of nucleotides that base pair by hydrogen bonds across the nitrogen basses of each nucleotide is such a way that A (adenine) always pairs with T (thymine) and G (guanine) always pairs with C (cytosine). The sequences are complementary in that each strand has the pair match (complimentary) base to the other all along the strand.
Dr. Claire
DNA Diva
The best way to do this in duplication of the DNA. AT and CG are complimentary to each other. So to adenine you fix the thymine and vise verse. To cytosine you fix the guanine and vise verse. You can not make a mistake or make one, very rarely.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
AATCGCCGTTA
TTCGGT
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
The complimentary DNA strand is ----> ATGCAA
acg-att
taacgggtac
B. Complimentary
yep. the new double strand is one of the original strands and a new strand
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.