answersLogoWhite

0


Best Answer

Wrong. UAC is the complimentary base sequence on the mRNA strand. RNA does not use the T nucleotide

don u think if it should be written like CAU coz rna polymerase reads 3 to 5 and gives 5 to 3

User Avatar

Wiki User

14y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

15y ago

AUGAAUGGCUCGAUCUGA- is the answer How do you get this answer?

It's simple. For every T in the DNA sequence, the RNA reads it as A. For every A in the DNA sequence, the RNA reads it as U. It's not T because the RNA doesn't have thymine, instead it has Uracil. For every G in the DNA sequence, the RNA reads it as C. For every C in the DNA sequence, the RNA reads it as G.

This answer is:
User Avatar

User Avatar

Wiki User

12y ago

Augaauggcucgaucuga

t=a

a=u

c=g

g=c

This answer is:
User Avatar

User Avatar

Wiki User

11y ago

cag ucc uag

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: If the base sequence of the DNA is gtcaggatc what would be the corresponding base sequence of the messenger rna?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What would be the mrna base sequence formed during transcription using the DNA sequence below?

Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.


A section of DNA has the base sequence GCTTAA the corresponding messanger RNA base sequence will be?

RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU


How do you translate this to to messenger RNA from DNA ccg atc gac cga?

The messenger RNA sequence would be: CCG UAG CUG GCU


If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?

The corresponding mRNA strand would be AUCG.


Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?

tttactgttgatggtagaactcgttgttct


What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?

I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


If a DNA stand sequence tagcaagc what will be the complimentary strand?

The complimentary strand of DNA would have the sequence: tacggctagttgg


What is the difference between codon and anticodon?

A codon is the triplet sequence in the messenger RNA (mRNA) transcript which specifies a corresponding amino acid (or a start or stop command). An anticodon is the corresponding triplet sequence on the transfer RNA (tRNA) which brings in the specific amino acid to the ribosome during translation. The anticodon is complementary to the codon, that is, if the codon is AUU, then the anticodon is UAA. There are no T (Thymine) nitrogen bases in mRNA. It's replaced by U (Uracil).


What sequence of mRNA would go with the DNA sequence of act?

If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA


What is a nth term in a sequence?

Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!


How would you write messenger's in possessive form?

The word messenger's is the possessive form for the noun messenger, for example the messenger's bicycle. The plural possessive form is messengers'.