Wrong. UAC is the complimentary base sequence on the mRNA strand. RNA does not use the T nucleotide
don u think if it should be written like CAU coz rna polymerase reads 3 to 5 and gives 5 to 3
AUGAAUGGCUCGAUCUGA- is the answer How do you get this answer?
It's simple. For every T in the DNA sequence, the RNA reads it as A. For every A in the DNA sequence, the RNA reads it as U. It's not T because the RNA doesn't have thymine, instead it has Uracil. For every G in the DNA sequence, the RNA reads it as C. For every C in the DNA sequence, the RNA reads it as G.
Augaauggcucgaucuga
t=a
a=u
c=g
g=c
cag ucc uag
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
The messenger RNA sequence would be: CCG UAG CUG GCU
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
ATAGCC is complementary to the base sequence TATCGG.
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
RNA is copied just like DNA, except thymine (T) is replaced by uracil (U), so the corresponding base sequence for GCTTAA would be CGAAUU
The messenger RNA sequence would be: CCG UAG CUG GCU
The corresponding mRNA strand would be AUCG.
tttactgttgatggtagaactcgttgttct
I though the question is asking the complimentary strand of the sequence. It would be TCCGGTAATCGGGATAAGCCCATATTTACC. Adenine pairs with thymine and guanine pair up cytosine by hydrogen bonds.
ATAGCC is complementary to the base sequence TATCGG.
The complimentary strand of DNA would have the sequence: tacggctagttgg
A codon is the triplet sequence in the messenger RNA (mRNA) transcript which specifies a corresponding amino acid (or a start or stop command). An anticodon is the corresponding triplet sequence on the transfer RNA (tRNA) which brings in the specific amino acid to the ribosome during translation. The anticodon is complementary to the codon, that is, if the codon is AUU, then the anticodon is UAA. There are no T (Thymine) nitrogen bases in mRNA. It's replaced by U (Uracil).
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
Well, it would depend what the sequence was...? If the sequence was 2,4,6,8,10,12,14,16,18,20, then the 9th term would be 18!
The word messenger's is the possessive form for the noun messenger, for example the messenger's bicycle. The plural possessive form is messengers'.