0
Movement
Respiration
Sensitivity
Circulation
Growth
Reproduction
Excretion
Nutrition
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Classifying living organisms?
MRS C GREN - Move, Respire, Sense, Cells, Grow, Reproduce, Excrete, Neutrition * Move - The organism must be able to change its position. * Respire - It muse breathe * Sense - It must be able to sense, e.g. hear, see, smell, feel pain. * Cells - It must be made up of cells. * Grow - It must be able to get bigger. * Reproduce - It must be able to produce offspring. * Excrete - It must get rid of waiste products. * Neutrituin - It must require neutrition to live.
What is a summary of mrs flowers?
mrs. flowers: there was a black women called mrs. flowers, she rarely smiled to anyone, but when it stops to a girl named Marguerite she always gives her hat simple smile. while mrs. flowers was shopping in the market, Marguerite's mom sent Marguerite's sister with mrs. flowers but mrs. flowers insisted to have Marguerite helping her. When they arrived home, mrs. flowers invited Marguerite for some Lemonade and some crisp sugar cookies, mrs. flowers had a book stand filled with romantic books, poem books, etc. Marguerite loved reading, she was good at marks and studying but she rarely talks, mrs. flowers read for her a poem:"It was the best of times, it was the worst of times. . . ." Marguerite really liked the poem, mrs. flowers said the she will give her some books to read them out loud, and she will never accept to have the books back without any benefit. Marguerite started reading it out loud and having courage, she lived her life that she thought she would never live. (this is the shortest summary I can make lol if u needed more help in any story i would like to help c: email: icansmile4ever@hotmail.com that email is only for help. lmml_storyhelper@yahoo.com)
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What aspects of MRS C GREN are relevant in yeast?
all because yeast is a living organism and anything living has to orthenticate withh all of MS GREN otherwise it isnt classified as a living organism
What does the C for cells mean in mrc C gren?
cells
On happy days what was Fonzie allowed to call Mrs.Cunningham?
Fonzie always called Mrs. Cunningham "Mrs. C".
What does ms gren stand for?
mrs c gren stands for M= movement: moving around R= Respiration: exchange of gases and glucose converted to energy S= Sensitivity: responding to touch, smell, light, gravity and sound C= Control: being able to controlthe organisms internel environment G= Growths:growing R= Reproduce: making more of the same type of organism (asexually or sexually) E= Excretion: wee and sweat and faeces N= Nutrition: eating
What has the author Mrs C Chesterton written?
Mrs C. Chesterton has written: 'The Chestertons'
What are the release dates for Me and Mrs- C- - 1984 TV?
Me and Mrs- C- - 1984 TV was released on: USA: 18 March 1984
Wyt does mrs gren stand for?
Mrs Gren stands for M- Movement- to be able to move around R- Respiration- to be able to breath S-Sensitivity- When someone hits you, you react to it G-Growth and Development- to be able to grow bigger R- Reproduction- to be able to reproduce and make young E- Excretion ( to excrete waste products like carbon dioxide) N- Nutrition Sometimes, there would be an H between the MRS and GREN, and it would stand for Homeostasis, which means to be able to control internal conditions.
What does Mrs. Higgins do what she does at the store?
C. Both A and B
What are the release dates for Me and Mrs- C- - 1986 The Jailbird 2-2?
Me and Mrs- C- - 1986 The Jailbird 2-2 was released on: USA: 18 April 1987
What are the release dates for Mrs- C- Oliver Iselin and Crew of Columbia - 1899?
Mrs- C- Oliver Iselin and Crew of Columbia - 1899 was released on: USA: October 1899
Which tv mom was known as Mrs C?
Mrs. Cunningham, Ritchie's mom on "Happy Days"
What has cheryl cole got written on her neck?
Mrs. C
