0
The continually elongating strand of new dna at one side of a replication fork during dna replication is known as?
Wiki User
∙ 11y ago
The strand of DNA that is being continually created is known as the leading strand.
The strand that is being created in sections/loops is known as the lagging strand.
The reason that these two strands are created differently is because the two strands of DNA run in different directions (they are anti-parallel). This means that because new nucleotides can only be added in a 5'-3' direction, the two strands cannot be created in the same method.
Wiki User
∙ 11y ago
Wiki User
∙ 13y agoleading
Add your answer:
Earn +20 pts
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
How many strands of DNA are used as templates during replication?
5'-3' : One strand
What are leading strands?
Leading strands are one of the two newly synthesized DNA strands during DNA replication. They are synthesized in a continuous manner in the 5' to 3' direction, following the replication fork. The leading strand is synthesized in the same direction as the replication fork is moving, allowing for continuous synthesis.
The continually elongating strand of new DNA at one side of a replication fork during replication is known as the?
Leading!
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What is Elongating?
new DNA strand is made using the original as a template
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
During dna replication each double helix produced consists of?
one parent strand and one new strand of DNA.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
There is a y shaped replication fork on each side of each replication bubble what are the sides of the replication fork called?
One is known as the Leading strand, and the other is known as the Lagging strand.
How many strands of DNA are used as templates during replication?
5'-3' : One strand
What is the definition of a lagging strand?
A lagging strand is one of two strands of DNA found at the replication fork, or junction, in the double helix; the other strand is called the leading strand. A lagging strand requires a slight delay before undergoing replication, and it must undergo replication discontinuously in small fragments.
What happens at the DNA replication fork?
The DNA replication fork is where the replication origin forms the Y shape. The replication fork moves down the DNA strand to the strand's end, resulting in every replication fork having a twin.
