answersLogoWhite

0

The complimentary sequence of ATCGGCTT will be TAGCCGAA. Because A pairs with T (2 hydrogen bonds), C pairs with G (3 hydrogen bond).

User Avatar

aania0450

Lvl 2
3y ago

What else can I help you with?

Related Questions

What is the complimentary DNA sequence for ttcacgag?

AAGTGCTC


What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT


What does complimentary sequence mean?

A complimentary sequence is a sequence of DNA or RNA that is complementary to another sequence. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). In RNA, adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).


What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?

The complimentary mRNA sequence would be: U-A-A-C-G-U


What is the correct sequece for t c a g g a c c g?

The correct complimentary DNA sequence would be AGTCCTGGC. The correct complimentary mRNA sequence would be AGUCCUGGC.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?

It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.


Which is the complimentary dna sequence to 5' atgcatgtca 3'?

The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


GGCAGTTCATGC What would be the sequence of bases on the complimentary stand?

Ccg tca agt acg


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What sequence of mRNA would go with the DNA sequence of act?

If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA