0
What else can I help you with?
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What does complimentary sequence mean?
A complimentary sequence is a sequence of DNA or RNA that is complementary to another sequence. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). In RNA, adenine (A) pairs with uracil (U) and cytosine (C) pairs with guanine (G).
What sequence of mRNA would go with the DNA sequence of act?
If the DNA sequence is ACT, the complimentary mRNA sequence would be UGA
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is the complimentary strand for DNA for the sequence base of cttaggcttacca?
lol i hate this question........its in meh science book
What is the complementary mRNA sequence to the DNA sequence A-A-T-G-G-C?
The complimentary mRNA sequence would be: U-A-A-C-G-U
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The base sequence of RNA is what to the DNA from which it is transcribed?
The base sequence of RNA is complementary to the DNA from which it is transcribed. This means that RNA contains the same genetic information as the DNA template, with thymine (T) being replaced by uracil (U).
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What determines the sequence of the nitrogenous bases in a new DNA strand?
It's complimentary pair. C--G and T--A
