0
The process is called DNA Transciption. It is when the DNA is copied into mRNA using base pairing - Adenine to Thymine, Guanine to Cytosine. Only the problem here is that when using mRNA, Thymine is replaced with a different nucleotide represented by a U. This is what we need the answer for.
Its Uracil...
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What do the template strands of DNA always begin with?
DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
Base pair in RNA?
RNA has four different base pairs. Adenine, cytosine, uracil, and guanine are the base pairs. These base pairs are made when a transcription initiation complex moves along DNA, unzips it, and creates RNA. Unlike DNA, RNA is one stranded and the base pair thymine is not present. Instead, uracil bonds with adenine.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA Polymerase
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
What does the G stand for in RNA strand?
It stands for one of 4 bases in RNA, guanine.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What do the template strands of DNA always begin with?
DNA is made of of two complimentary strands, the coding strand and the template strand. When DNA is transcribed (made into messenger RNA which can be converted by ribosomes into proteins) the DNA splits open and free nucleotide bases bind to the template strand. DNA is made of T/C/G/A and RNA is made of U/C/G/A nucleotide bases. G and C bind (they are said to be 'complimentary') A and T bind and in RNA U and A bind (so U replaces T.) The newly formed RNA strand (made on the template stand of DNA) is 'complimentary' to the template but the same as the coding strand of DNA. Hence the template is used to produce RNA which is a copy of the coding strand. Either strand of DNA can act as the template/coding strand. Hope that is a little bit helpful!
What modifications are necessary to rewrite the following DNA strand GGCATTGCA as a RNA strand?
I always place the "strand" vertically. G G C A T T G C A Then i think.. what bonds with what? G with C A with T and when RNA A with U. So in order for the DNA strand and the RNA strand to bond.. they have to have the appropriate reflections. G - C G - C C - G A - U T - A T - A G - C C - G A - U Therefore you're modifications have been made and your RNA strand is this: CCGUAACGU Hope this helps :)
What rna strand is complementary to the DNA strand gtagtca?
As long as the DNA strand sequence "CTAGGTTAC" is in the 5' to 3' position, the correct RNA sequence would be "CUAGGUUAC". RNA is identical to the coding strand, which is always read 5' to 3'. The only difference is U replaces T.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
Is influenza single strand or double strand RNA?
It is single stranded RNA. Importantly, it is also a segmented genome that allows it to have large genetic diversity.
Base pair in RNA?
RNA has four different base pairs. Adenine, cytosine, uracil, and guanine are the base pairs. These base pairs are made when a transcription initiation complex moves along DNA, unzips it, and creates RNA. Unlike DNA, RNA is one stranded and the base pair thymine is not present. Instead, uracil bonds with adenine.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
RNA Polymerase is the enzyme responsible for creating a strand of RNA.
What is non coding side of DNA for ATGC?
The non-coding side of DNA, also known as the non-coding strand or the template strand, serves as a blueprint for producing RNA molecules during the process of transcription. Unlike the coding strand, which has the same sequence as the RNA product, the non-coding strand has a complementary sequence to the RNA molecule, with the nucleotides A, T, G, and C pairing respectively with U, A, C, and G in RNA.
What is the complementary strand to the following sequence UTTCTTT?
Assuming RNA (U): TUUGUUU Assuming DNA: TAAGAAA
