0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What is the role of the DNA new strand?
It is a copy of the Dna original strand.
What would match the DNA strand TCCGAACGTC?
The DNA strand, AGGCTTGCAG.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
CCAATTG
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
IMPORTANT After DNA replication does half of the old strand leave with half of the new strand?
The process of DNA replication is described as being semi-conservative. The complementary DNA strands are pulled apart, new matching nucleotides are connected to each separate strand, and the result is two new strands that each contain exactly one-half of the original DNA strand.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
A major difference in RNA as compared to DNA is?
RNA can move and DNA cant. DNA has a double helix strand and RNA is a single strand.
What is the strand?
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
Name of the DNA strand which is copied to make mRNA?
This is typically called the template DNA, which is the anti-sense strand of DNA. The strand that is not transcribed is called the sense strand.
What is the role of the DNA new strand?
It is a copy of the Dna original strand.
What would match the DNA strand TCCGAACGTC?
The DNA strand, AGGCTTGCAG.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
