answersLogoWhite

0


Best Answer

In DNA:

5' attgcat 3'

3' taacgta 5'

User Avatar

Wiki User

14y ago
This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What is attgcat complementary strand sequence?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Continue Learning about Biology

Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?

The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA


What does it mean to say DNA polymerase reads a template strand to make the complementary strand?

During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.

Related questions

What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the sequence of complementary strand?

TGCA


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the complementary base sequence of DNA strand?

TGCA


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


What complementary strand to the DNA sequence TAGTCA is?

The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.


What is the complementary strand of DNA?

Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What sequence in human DNA is the forward primer complementary to?

forward primers are complementary to anti sense strand of the dsDNA


A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?

tcaa --remember a attracts t while c attracts g