In DNA:
5' attgcat 3'
3' taacgta 5'
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
TGCA
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
The base sequence CAGACT corresponds to the DNA strand, and it would be complementary to the RNA strand with the sequence GUCUGA. Therefore, the original strand is the DNA strand.
its tcaa
TGCA
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
auc
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
TGCA
TGCA
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
The complimentary strand of MRNA would be AAUUCCGG.