0
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Wiki User
∙ 11y ago
t-c-t-c-c-t-a-g-t-g-g-t-t-t-t-a-a
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
What would be the base sequence of the complementary mRNA strand?
TGCA
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What be would the complementary strand of DNA for the following sequence of bases?
lol i hate this question........its in meh science book
How many bases does a double helix have after the complementary strand is added?
double the amount of bases (or x2)
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?
TGCA
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
How does DNA copy of itself?
DNA makes copies of itself through the process of replication. Because the nucleotide bases are complementary, they automatically make the other strand of complementary bases when the division of the cell occurs.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is the order of bases on the complementary side of the strand B from left to right?
AAACCCGTT I have an assignment for this SO I am 90% sure, but I know it's right.
What does complementary bases in the structure of DNA mean?
The structure of DNA relies on a base-pairing rule. This means that in DNA, Adenine binds to Thymine and Guanine binds to Cytosine. The complementary base is the base that binds to the base in question. Therefore A is complementary to T, C is complementary to G, etc. So if you had a strand of DNA, for example; ATT-CCA-GTC The complementary strand (which would bind to the above) would be; TAA-GGT-CAG
