0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What complementary strand of DNA would be produced from the strand DNA shown below?
Assuming it's 5' to 3', The complementary strand would be 3' G-A-A-T-C-C-G-A-A-T-G-G-T 5'
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
gcgtatagtccg is the DNA compliment
Suppose mRNA was changed would the same tRNA molecule still attach to the strand?
no. because if mRNA was changed,trna will mixed and change letters.
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What complementary strand of DNA would be produced from the strand DNA shown below?
Assuming it's 5' to 3', The complementary strand would be 3' G-A-A-T-C-C-G-A-A-T-G-G-T 5'
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
What is the new strand complementary to the old strand?
DNA strands are said to be complementary because they both match up with eachother; A with T and C with G. So if you have the strand ATGGCTA the complementary strand (the other half of the double helix) would read TACCGAT. So if you know one side of the strand then you can describe the whole.
On a crossword puzzle What would Maroon be?
The number of letters would be helpful. Maroon can be a brownish-crimson color, but if the word is six letters long, it is most often "strand."
DNA molecule antiparallel Why?
The DNA molecule is anti-parallel. This is because the two strands are the opposite of one another, such that if one strand has the base sequence ATC, the opposite strand would have the base sequence TAG.
What would the other strand of DNA be - g g t c g a a t?
5' GGTCGAAT 3' --Top strand 3 'CCAGCTTA 5' ---Other strand
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?
gcgtatagtccg is the DNA compliment
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
