0
What would the amino acid be if A is added after the first codon?
Wiki User
∙ 8y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Why would an insertion or deletion mutation have more effect than a substitution mutation?
Base-pair insertions have a greater effect because they shift the information on the DNA down and change all following information, whereas substitutions may change only one amino acid or have no effect. -The base-pairs code for amino acids in groups of three. If just one base is added in, then this grouping is shifted upstream by one. The incorrect amino acids will be coded for and added to the protein being built. It could possibly stop the protein from being synthesized fully if the change creates a stop codon. This usually hinders the protein from functioning. -Base-pair substitution mutations only affect the codon (set of 3 base pairs) that it actually occurs in. If the mutation is in the first base-pair of the codon then the amino acid will change. If the mutation is in the second or third position of the codon then amino acid may or may not change; this is because amino acids can be coded for by more than one codon, but the first base-pair (and sometimes the second) is usually the same. A substitution can also change a codon to a stop codon. This may keep the amino acid the same, change only one amino acid (which does not always stop the protein from working), or cause the protein to prematurely stop being built.
What is the maximum number of amino acids that could be coded for by a sextion of mrna with the sequence guucagaacugu?
A codon is three bases long - so this section of mRNA would have 4 codons; UGA-UUC-AGU-AAC.Each codon relates to a specific amino acid (but several codons can code for the same amino acid, for example both UUU and UUC code for the amino acid Phenylalanine).Normally if you have four codons, such as this section of mRNA, the maximum number of amino acids you could have would be four. However, the first codon in this section, UGA, is actually a STOP codon. This means that when the ribosome reaches this codon, no further amino acids will be joined.This means that no amino acids could be coded for with this section of mRNA. (If the order of the codons was reversed, making the STOP codon last, then the answer would be three).
What part of the dna sequence would be involved if the trna amino acid was agc?
An RNA codon which reads "UCG" would pair with a tRNA molecule which has the anti-codon "AGC".
How does an anticodon compare to a codon?
The anticodon is a sequence of three unpaired nucleotides in transfer RNA, which can bind through base pairing, to the complementary triplet of nucleotides, or codon in a messenger RNA molecule. The codon makes up the genetic code, the anticodon makes the amino acid.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
Complementary to an mRNA codon?
it depends on the codon spcified. The tRNA will have the complementary strand along with an amino acid, for which is specified by the mRNA. if the mRNA codon was "CGA" the tRNA codon would have an amino acid and the complementary codon of "GCU"
In which molecule would you find an anti-codon?
an anti-codon is a code for an amino acid found on protein
What amino acid is coded for by the codon AUC?
The anticodon would be UAG, and the amino acid coded for is isoleucine.
If an mRNA is made up of 60 bases how many codons does it contain and how many amino acid does it code for?
A codon is exactly three bases long, so an mRNA strand with 60 bases would contain 20 codons. The first codon will encode for methionine (this is called the "start" codon) and the last codon will be a "stop" codon, which does not encode for an amino acid. Thus, an mRNA strand of 60 bases will code for 19 amino acids. Keep in mind, it is possible for a stop codon to be anywhere on the mRNA strand, and when a stop codon reaches the ribosome, translation must stop. For example, if an mRNA strand contained 30 codons, and the 15th were a stop codon, the mRNA would only code for 14 amino acids and then be done. The other 15 codons would go untranslated.
What would be the first three amino acids in the protein formed from this gene uagcgagg?
Each amino acid is coded for by a 3-base sequence known as a codon. Therefore you would need 9 bases to code for 3 amino acids.The sequence UAG-CGA-GG would not add three amino acids to a protein.For the sequence UAG-CGA-GG:UAG is a STOP codon - translation would cease at this point and no further amino acids would be added.CGA codes for Arginine.GG does not code for an amino acid - it would need one more base to be a codon. GGU, GGA, GGG and GGC all code for Glycine.
How might one missing nucleotide or the insertion of one additional nucleotide in a DNA strand alter the formation of the translated protein?
Deletion of just one nucleotide in a protein-coding part of a gene will cause a "frameshift mutation." Since the nucleotides are read in groups of three (codons) along the gene, the groupings will change and the protein that results is likely to be completely different.
If UCA is a codon that specifies the amino acid serin What would be the base sequence for the anticodon on tRNA that pairs with this codon?
It will be AGU.
Why would an insertion or deletion mutation have more effect than a substitution mutation?
Base-pair insertions have a greater effect because they shift the information on the DNA down and change all following information, whereas substitutions may change only one amino acid or have no effect. -The base-pairs code for amino acids in groups of three. If just one base is added in, then this grouping is shifted upstream by one. The incorrect amino acids will be coded for and added to the protein being built. It could possibly stop the protein from being synthesized fully if the change creates a stop codon. This usually hinders the protein from functioning. -Base-pair substitution mutations only affect the codon (set of 3 base pairs) that it actually occurs in. If the mutation is in the first base-pair of the codon then the amino acid will change. If the mutation is in the second or third position of the codon then amino acid may or may not change; this is because amino acids can be coded for by more than one codon, but the first base-pair (and sometimes the second) is usually the same. A substitution can also change a codon to a stop codon. This may keep the amino acid the same, change only one amino acid (which does not always stop the protein from working), or cause the protein to prematurely stop being built.
UAG is a stop codon. What might happen if the uracil in this codon was changed to cytosine?
The new codon would code for glutamine. Translation would continue until the ribosome encountered another stop codon or ran out of messenger RNA to translate.ExplanationUAG is an RNA codon. If the uracil (U) in the codon were changed to cytosine (C), the codon would be CAG, which codes for the amino acid glutamine.
What is the maximum number of amino acids that could be coded for by a sextion of mrna with the sequence guucagaacugu?
A codon is three bases long - so this section of mRNA would have 4 codons; UGA-UUC-AGU-AAC.Each codon relates to a specific amino acid (but several codons can code for the same amino acid, for example both UUU and UUC code for the amino acid Phenylalanine).Normally if you have four codons, such as this section of mRNA, the maximum number of amino acids you could have would be four. However, the first codon in this section, UGA, is actually a STOP codon. This means that when the ribosome reaches this codon, no further amino acids will be joined.This means that no amino acids could be coded for with this section of mRNA. (If the order of the codons was reversed, making the STOP codon last, then the answer would be three).
What part of the dna sequence would be involved if the trna amino acid was agc?
An RNA codon which reads "UCG" would pair with a tRNA molecule which has the anti-codon "AGC".
How does an anticodon compare to a codon?
The anticodon is a sequence of three unpaired nucleotides in transfer RNA, which can bind through base pairing, to the complementary triplet of nucleotides, or codon in a messenger RNA molecule. The codon makes up the genetic code, the anticodon makes the amino acid.
