0
Uracil in Watson-Crick base-pairing though non-standard pairs exist.
Wiki User
∙ 11y ago
Wiki User
∙ 11y agoThyamine T
Add your answer:
Earn +20 pts
Which step happens first in DNA replications?
The first thing that happens is a replication structure binds to the DNA molecule. This is usually a signalling molecule or some type of protein. Next, this replication structure attracts DNA helicase enzymes which "unzip" the double stranded helix.
In what phase of meiosis does chromosomes line up along equator not in homologous pairs?
AnaPhase1
Is the epicentre always on a fault line?
no
How long does it take for the earth to get lined up with the sun?
The earth and the sun always form a line. They are the end points of that line and therefore are always lined up.
Where do the chromosomes line up along the cell?
chromosomes line up at the spindle equator during metaphase! chromosomes line up at the spindle equator during metaphase!
Are linear pairs also supplementary?
not necesarily, supplementary angles have to add up to 180degrees so they can b linear pairs if their on the same line but not always
How many pairs of intersecting line segments does a cube have?
A cube has six pairs of intersecting line segments. These six pairs will total 72 lines in a cube.
Which of these pairs of points defines a line with a slope of -1?
None of "these" pairs.
How many pairs of parallel line segments does a stop sign have?
how many pairs of parallel line segments does a stop sigh have
How many strands of wire does a digital subscriber line use?
two.
What happens to chromosomes during Meiosis 2?
the chromosomes pairs line in the center of the cell the chromosomes pairs line in the center of the cell
What do you call a line of school children walking in pairs in a line?
Children
How many parallel line segments in triangle and its midpoint triangle?
Three pairs. The line joining the midpoints of any two sides of a triangle is always parallel to the third side of the triangle (and half its length).
How many pairs of parallel lines does a trapizoid have?
there are two pairs of parrell lines in a trapizoid, the top line and bottom line. I hope I answered your question!!=)=)
The chromosomes in the nucleus of a cell contains a code known as?
The Genetic code.DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:ACCTAATCAGAATAAACCACA (and so on)the proteins attach in a line AND from one helix to the other.A - G| |T - C| |C - A| |G - Aand so on - it spins downward.
How many pairs of intersecting line segments does a square have?
Four pairs, which intersect at the four vertices!
How do you plot points on a coordinate plane?
When plotting ordered pairs,always begin at the point of origin (center) and plot along the x axis line first then on the y axis line second/next.☺♥
