0
Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?
Wiki User
∙ 11y ago
Verified answer
Gca ta
Wiki User
∙ 8y ago
Ethel Nitzsche
A Gca ta strand
yessie nova
TAGCCGATGCATGGAT
Rashid Ali
Wiki User
∙ 11y agoTagccgatgcatggat
Wiki User
∙ 14y agoTAGCCGATGCATGGAT
Wiki User
∙ 13y agoG-G-T-A-G-C
Why is the replication process is a source of few mutations?
Some mutations are due to errors in DNA replication. During the replication process, DNA polymerase chooses complementary nucleotide triphosphates from the cellular pool. Then the nucleotide triphosphate is converted to a nucleotide monophosphate and aligned with the template nucleotide. A mismatched nucleotide slips through this selection process only onece per 100,000 base pairs at most. The mismatched nucleotide causes a pause in replication, during which it is excised from the daughter strand and replaced with the correct nucleotide. After this so-called proofreading has occurred, the error rate is only one per 1 billion base pairs.
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
The reaction catalyzed by DNA polymerase is?
There are different types of DNA polymerase depending if it's from a eukaryotic or prokaryotic cell each performing specific tasks. Basically DNA polymerase catalyzes the formation of a polymer, a DNA strand, from many monomers, deoxyribonucleotides.
The process by which DNA polymerase is able to correct mismatched nucleotides is called?
replication
Is The lagging strand the strands of parental DNA?
which statement about dna replication is correct? A. the leading strand is one of the strands of parnetal Dna b. the leading strand is built continuously, and the lagging strand is built in pieces c. the lagging strand is one of the strands of parental Dna d. Dna ligase helps assemble the leading strand e. the lagging strand is built continuously
Why is the replication process is a source of few mutations?
Some mutations are due to errors in DNA replication. During the replication process, DNA polymerase chooses complementary nucleotide triphosphates from the cellular pool. Then the nucleotide triphosphate is converted to a nucleotide monophosphate and aligned with the template nucleotide. A mismatched nucleotide slips through this selection process only onece per 100,000 base pairs at most. The mismatched nucleotide causes a pause in replication, during which it is excised from the daughter strand and replaced with the correct nucleotide. After this so-called proofreading has occurred, the error rate is only one per 1 billion base pairs.
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
ctgtagcaactgatgccgactag
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
How do you abbreviate the word 'template'?
I am not sure how correct it looks but this is how I abbreviate the word template. TPL I hope this helps, David - phprocket.com
The reaction catalyzed by DNA polymerase is?
There are different types of DNA polymerase depending if it's from a eukaryotic or prokaryotic cell each performing specific tasks. Basically DNA polymerase catalyzes the formation of a polymer, a DNA strand, from many monomers, deoxyribonucleotides.
How do you spell templet?
The correct spelling of the word for a pattern or guide is template.
Is this phrase correct- The drawing is complementary to the other colors in the room?
it sounds good to me. :)
The process by which DNA polymerase is able to correct mismatched nucleotides is called?
replication
What two scientists discovered the correct mechanism for DNA replication?
Meselson and Stahl
Who performed the experiments that elucidated the correct mechanism of DNA replication?
Watson and Crick
Can a supplementary angle be a complementary angle?
A supplementary angle can not be a complementary angle. The complementary angle has 2 angles equal 90... but a supplementary angle is X2 that much (108). * * * * * Nearly correct. 90 x 2 is 180, not 108!
Is The lagging strand the strands of parental DNA?
which statement about dna replication is correct? A. the leading strand is one of the strands of parnetal Dna b. the leading strand is built continuously, and the lagging strand is built in pieces c. the lagging strand is one of the strands of parental Dna d. Dna ligase helps assemble the leading strand e. the lagging strand is built continuously
