0
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Wiki User
∙ 13y ago
ctgtagcaactgatgccgactag
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Why is it advantageous to have weak hydrogen bonds between complementary pairs?
So the double helix can be easily unzipped by helicase so DNA polymerase can replicate on one strand of DNA.
How are DNA hybridization experiments conducted?
Hybridization is the key concept here. Just like the 'Lock and Key Concept' that Envelope Enzymes, Dna hybridization Techniques begin with a Construct - the Dna sequence - and is followed by the Complementary Template.'
How many total hydrogen bonds would exist between the dna strand and its complementary strand 5'ACTCTAG 3'?
15
What is the complementary strand of ttc agt aca?
The complementary DNA strand would be TTCGTT.But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
What type of bonding occurs between DNA nucleotides?
Covalent bonding occurs between the nucelotides between the phosphate, deoxyribose sugar and organic base of a single DNA strand and hydrogen bonding holds the complementary bases of two DNA strands together.
What is the complementary mrna starnd to dna sequence cggatcat?
GCCUAGUA
The enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence is?
DNA polymerase
What is the enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence?
DNA polymerase
How many strands of DNA are used to make complementary strands of DNA?
i believe its 2. correct me if im wrong
How are complementary of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
What binds complementary bases together?
The complementary bases in DNA are bind together by hydrogne bonds Adinine bind with thymine by 2 H-bonds Guanine bind with cytosine by 3 H- bonds
. How are complementary strands of DNA held together?
Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
5' TGACATGCAT 3' The sequence is complementary and in the correct orientation.
What does the reaction in the test tube generate when complementary DNA is made for reading DNAen complementary?
recombinant DNA strand.
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
