answersLogoWhite

0

ctgtagcaactgatgccgactag

User Avatar

Wiki User

14y ago

What else can I help you with?

Continue Learning about Chemistry

What is the complementary base pairing between adenine and thymine in DNA?

Adenine pairs with thymine in DNA through hydrogen bonds, forming a complementary base pair.


What are the correct base-pairing rules of DNA?

The correct base-pairing rules in DNA are adenine (A) pairing with thymine (T) and guanine (G) pairing with cytosine (C). This forms complementary base pairs that contribute to the double-helix structure of DNA.


How does RNA complementary base pairing contribute to the process of protein synthesis?

RNA complementary base pairing plays a crucial role in protein synthesis by allowing the transfer of genetic information from DNA to RNA and then to proteins. During protein synthesis, RNA molecules use complementary base pairing to match with specific sequences on the DNA template, forming a template for the assembly of amino acids into proteins. This process ensures that the correct amino acids are added in the correct order, ultimately determining the structure and function of the protein being synthesized.


What is complementary base pairing and how does it contribute to the stability of DNA molecules?

Complementary base pairing is the specific bonding between adenine and thymine, and between cytosine and guanine in DNA molecules. This pairing ensures that the two strands of DNA are held together in a stable double helix structure. The hydrogen bonds formed between the complementary base pairs contribute to the overall stability of the DNA molecule.


Why is the hybridization probe said to be complementary?

The hybridization probe is said to be complementary because it is designed to bind specifically to its complementary target sequence in the DNA or RNA of interest. This complementary binding is necessary for the probe to accurately detect and identify the target sequence in a sample.

Related Questions

What is the complementary mrna starnd to dna sequence cggatcat?

GCCUAGUA


What are the correct complementary base pairs in DNA?

The correct complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).


What is the enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence?

DNA polymerase is the enzyme responsible for replicating DNA by adding complementary nucleotides in the correct sequence during DNA synthesis.


The enzyme that is responsible for replicating molecules of DNA by attaching complementary bases in the correct sequence is?

DNA polymerase


How are complementary of DNA held together?

Complementary strands of DNA are held together by hydrogen bonds connecting complementary bases.


Guanine is a complementary base for which of these DNA nucleotides?

Guanine is a complementary base for cytosine in DNA.


What is complementary DNA strand for att-cga-tgc?

The complementary strand of the DNA is TAA-GCT-ACG


Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?

The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.


How many strands of DNA are used to make complementary strands of DNA?

Two strands of DNA are used to make complementary strands of DNA. One original strand serves as a template for the synthesis of a new strand, resulting in a double-stranded DNA molecule with base pairing between the original and newly synthesized strands.


How many strands of DNA are used to make complementary DNA?

Two strands of DNA are used to make complementary DNA during the process of DNA replication. This involves separating the two original DNA strands and using each as a template to build a new complementary strand.


What does the reaction in the test tube generate when complementary DNA is made for reading DNAen complementary?

recombinant DNA strand.