0
What else can I help you with?
What would be the base sequence for the complementary DNA formed from CGT TA?
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
The corresponding strand is TTT act gtt gat ggt aga act cgt tgt tct. To find it, you need to identify the complementary base pairs: adenine (A) with thymine (T), cytosine (C) with guanine (G). Then, simply replace each base with its complementary one to obtain the other side of the DNA helix.
What complementary strand of DNA would be produced from the DNA strand cgt ta?
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
What would be the stand of complementary dna produced by the strand of dna shown below cgt ata?
Gca-tat gca ta The answer is AGC CT cat gt
The DNA code is cgt what is the sequence of nucleotides in the transcribed mrna?
TCU
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
Base Sequence CGT ACG GCT AC WHAT WOULD BE the base sequence formed by transcription?
During transcription, the DNA sequence is converted into a complementary RNA sequence. For the given DNA base sequence CGT ACG GCT AC, the corresponding RNA sequence would be GCA UGC CGA UG. This involves replacing thymine (T) with uracil (U) in RNA.
What should the strand of complementary DNA produced by cgt ata?
The complementary DNA strand produced from the sequence "cgt ata" would be "gca tat." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
What is the match for CGT AT?
Gca ta
Who was the mayor of newyork in 2001?
maya cgt
Example of a frameshift mutation of CGT AT gene?
A frameshift mutation occurs when nucleotides are inserted or deleted from a DNA sequence, leading to a shift in the reading frame during translation. For example, if the CGT AT gene has a sequence like "CGT ATG," and a single nucleotide is deleted, such as changing it to "CGT AG," this alters the codons downstream, potentially resulting in a completely different and nonfunctional protein. These mutations can have significant consequences, often leading to diseases or malfunctions in cellular processes.
What would be the base sequence for the complementary DNA formed from CGT TA?
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
What is the value of a Dan Wesson 357 magnum cgt?
100-400
What is the easiest way to get into the product design business?
Get a degree in CGT or engineering.
What does high CGT blood test mean?
What causes elevated GGT related to liver
What are the steps involved in transcription and translation of a gene?
Aca tag gct aat gct aat cgt gca cga tct gaa cgatgt atc cga tta cga tta gca cgt gct aga ctt gct
