0
You can get it by blood transfusions.
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is scerosis of the liver?
Cirrhosis of the liver in the basic "killing off" of healthy liver cells. The causes are linked to excessive alcohol use or abuse and Hepatitus C. What smoking does to the lungs, excessive alcohol and Hepatitus C does to the liver.
What are traits about chromosome number 8?
There are quite a few trait about chromosome number 8 But here are a few.Werner SyndromeCohen SyndromeMonocyticHemolytic anemiaGaint Cell hepatitus, neonatalEpilepsy
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
Can you be insured if you have Hepatitus C?
Individual Health Insurance
Whats the common name for viral hepatitis?
Hepatitus A, B, or C
Are aids and hepatitus b and c all bloodborne pathogens?
Yes.
What is scerosis of the liver?
Cirrhosis of the liver in the basic "killing off" of healthy liver cells. The causes are linked to excessive alcohol use or abuse and Hepatitus C. What smoking does to the lungs, excessive alcohol and Hepatitus C does to the liver.
Can you contract hepatitus c from sharing a needle that's been rinsed off?
i believe so
Can someone with hepatitis a get married and have a kid like normal people?
depends on which hepatitus you are talking about, a,b,c?
From where in mount pleasant i can get free vaccinations for hepatitus b and c?
There is no hepatitis C vaccine. Free vaccines, if available, would be through the department of health.
Issues issues issues issues issues issues issues what do you need next?
you get issues, like hepatitus C
Hepatitus b can be spread by?
by sexuall activity
What did irving millman invent?
he invented the vaccine against hepatitus and hepatitus disease which is a liver disease
What does hepa stand for?
Hepatitus A
Was there a Greek god named Hepatitus?
No, there was never a Greek god named Hepatitus. Hepatitis is a disease. I suppose that the closest sounding god to that is Hephaestus.
