Cytosine can be various colors such as blue, purple and red. Cytosine in the DNA strand is the color purple.
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
The complement strand of CCTAGCT would be GGATCGA.
A DNA strand is made up of alternating sugar (deoxyribose) and phosphate molecules. The nitrogenous bases (adenine, thymine, cytosine, and guanine) are attached to the sugar molecules, forming the "rungs" of the DNA ladder.
The complimentary DNA strand to the template sequence atgccatgg is tacggtacc. This is because DNA bases always pair up in a specific way: adenine (A) with thymine (T) and cytosine (C) with guanine (G).
The complementary DNA strand to TCCGAACGTC is AGGCTTGCAA. This is because adenine pairs with thymine and cytosine pairs with guanine in DNA.
A - adenineT - thymineG - guanineC - cytosine
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
The complementary DNA sequence to CTA is GAT. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). So, for every C in one strand, there should be a G in the complementary strand, and for every T in the original strand, there should be an A in the complementary strand.
Cytosine and Guanine are complementary. Therefore the paired strand would be GGC.
four:which areadeninethynimeguaninecytosine
The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.
The complementary DNA strand that attaches to ATCGTTA is TAGCAAT. This is determined by the base pairing rules in DNA where adenine pairs with thymine and cytosine pairs with guanine.
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.
Adenine Thymine Cytosine Guanine Adenine pairs up with Thymine Cytosine pairs up with Guanine
The complement strand of CCTAGCT would be GGATCGA.