answersLogoWhite

0

Cytosine can be various colors such as blue, purple and red. Cytosine in the DNA strand is the color purple.

User Avatar

Wiki User

11y ago

What else can I help you with?

Related Questions

What would match the DNA strand TCCGAACGTC?

The complementary DNA strand to TCCGAACGTC is AGGCTTGCAA. This is because adenine pairs with thymine and cytosine pairs with guanine in DNA.


What is C in the DNA strand?

A - adenineT - thymineG - guanineC - cytosine


What complementary strand of DNA would be produced from the DNA strand cgt ta?

The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.


Ifa DNA triplet is CTA then what is the complimentary DNA?

The complementary DNA sequence to CTA is GAT. In DNA, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). So, for every C in one strand, there should be a G in the complementary strand, and for every T in the original strand, there should be an A in the complementary strand.


What strand of DNA is complement to CCATCG?

Cytosine and Guanine are complementary. Therefore the paired strand would be GGC.


How many different bases can be found in a strand of DNA?

four:which areadeninethynimeguaninecytosine


If you had a small single strand of DNA with the nucleotide sequence cagtact what would the sequence be for the other DNA strand?

The complementary DNA strand would be GTACTGA. In DNA, adenine pairs with thymine and cytosine pairs with guanine.


What DNA strand attaches to atcgtta?

The complementary DNA strand that attaches to ATCGTTA is TAGCAAT. This is determined by the base pairing rules in DNA where adenine pairs with thymine and cytosine pairs with guanine.


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


If one strand of DNA has a nucleotide base sequence of tcaggtccat?

If one strand of DNA has a nucleotide base sequence of tcaggtccat, its complementary strand is agtccaggta. Adenine pairs with thymine, while guanine pairs with cytosine.


DNA strand have what 4 bases?

Adenine Thymine Cytosine Guanine Adenine pairs up with Thymine Cytosine pairs up with Guanine


What is the strand of CCTAGCT?

The complement strand of CCTAGCT would be GGATCGA.