0
First, separate the letters into codons so they are easier to read:
ggc tat atc ctg cgc tat acg cta
Then, convert them into mrna, replacing the g's with c's, the c's with g's, the t's with a's, and the a's with u's. Unlike DNA, RNA doesn't contain t, but it can still translate t's.
ccg aua uag gac gcg aua ugc gau
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?
Gca ta
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
Consider a strand of DNA with this sequence AAA tga caa cta cca tct tga gca aca aga what is the corresponding sequence of the other side of the DNA helix how would you get the answer?
tttactgttgatggtagaactcgttgttct
What strand mrna would be produced from the strand of DNA gca tta?
UGA CUG
What complementary strands of DNA would be produced from the strand of DNA?
Gca-tat gca ta The answer is AGC CT cat gt
What strand of DNA would be produced from from the template strand of DNA shown below?
Ttg ga
What order of bases on mRNA will match a sequence on tRNA of UUA?
If the tRNA has the sequence UUA, then the mRNA it reads from will have the sequence complementary to UUA, which is AAU. RNA uses the nucleic acid uracil instead of the DNA counterpart, thymine.
Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?
Gca ta
A T C G G A what would the complimentary mRNA strand read?
The Rna triplet codon GUA, Thymine being replaced by Uracil in all Rna's.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
The base sequence of RNA is what to the DNA from which it is transcribed?
complimentary For example, if the DNA codon is GCA, the complimentary mRNA codon will be CGU, according to the base pairing rule.
What is the sequence of bases of the mrna for tacaaatttgcaaccact?
TAC AAA TTT GCA ACC ACT (DNA) AUG UUU AAA CGU UGG UGA (mRNA)
What is the complementary strand of ttc agt aca?
The complementary DNA strand would be TTCGTT.But assuming that the given strand is of mRNA, the DNA template would be TTCGTT and the tRNA would be UUCGUU.
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
