0
The 10 Commandments
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
What is meant by 10 C R of a T?
it means10 C R of a T :)
When was T. C. Jones born?
T. C. Jones was born on 1920-10-26.
What is 10 C R of a T?
10 Cube Root of a Thousand
What is 10 c in the o t?
10 Commandment in the Old Testament
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What are the release dates for W-I-T-C-H- - 2004 J Is for Jewel 2-10?
W-I-T-C-H- - 2004 J Is for Jewel 2-10 was released on: USA: 14 August 2006
10 d in a t n including the a c?
10 digits in a telephone number including the area code
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
How many sandwiches can you make out of ham turkey roastbeef American cheese Swiss cheese and cheddar cheese?
24 different ways. wow that took a while turkey- TU cheese- C lettuce- L tomato- T Tu, C, L, T Tu, C, T L Tu, L,C,T Tu,L,T,C Tu,C,T,L Tu,C,L,T C,TU,L,T C,TU,T,L C,L,TU,T C,L,T,TU C,T,L,TU C,T,TU,L L,TU,T,C L,TU,C,T L,C,TU,T L,C,T,TU L,T,TU,C L,T,C,TU T,TU,C,L T,TU,L,C T,L,TU,C T,L,C,TU T,C,TU,L T,C,L,TU
