answersLogoWhite

0

t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)

User Avatar

Wiki User

16y ago

What else can I help you with?

Continue Learning about Biology
Related Questions

What is the complementary DNA of atgcatgta-3'?

The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.


What is the complementary DNA for TAC GG?

The complementary strand of this DNA sequence is... A T G C T A A C C


What strand of DNA would be produced from ATG CGA?

The strand of DNA complementary to the given sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, A pairs with T, T with A, C with G, and G with C in the complementary strand.


The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?

The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.


What DNA strand would be produced with tac gg?

The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."


What is the complementary strand to AGTCACGGTATCTA?

give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?


Are the two strands of DNA identical or complementary?

I don't know what you mean by complementary, so I'll use an example. If a section of one strand of DNA is ATC GGA TAC ACC, then the other will be (in the same direction) TAG CCT ATG TGG If you are looking for the messenger RNA code, change all the Ts to Us in the second code of my answer. Hope this helps!


What strand of mRNA would be produced from the strand of DNA shown below?

The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.


What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?

The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA


If this strand of DNA was used what would be the complementary DNA produced tac gg?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


Which is the correct transcribed RNA strand for the DNA strand agc caa atg?

The correct transcribed RNA strand for the DNA sequence AGC CAA ATG is UCG GUU UAC. In RNA, adenine (A) is replaced by uracil (U) and thymine (T) by adenine (A).