answersLogoWhite

0

C - G, A - T. If you want a complementary strand to this as a DNA sequence, it would be GTACAG. If that strand is mRNA and you're looking to convert it to tRNA, the 'T' simply becomes a 'U' (uracil), so then it would be GUACAG.

User Avatar

Wiki User

16y ago

What else can I help you with?

Related Questions

Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


Which of these show is the correct complementary strand of DNA that would be made during DNA replication based on this template strand ATCGGCTACGTACCTA?

Gca ta


What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?

The template strand is used to make a complementary copy. This is a type of DNA strand.


What is the correct complimentary DNA stand for the following ACGCT?

The correct complementary DNA strand for the sequence ACGCT is TGCGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its corresponding complementary base.


What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


What is complementary DNA strand for att-cga-tgc?

The complementary strand of the DNA is TAA-GCT-ACG


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


What strand is the messenger rna complementary to?

mRNA is complementary to the template strand of DNA during transcription. The template strand serves as a template for mRNA synthesis, directing the formation of a complementary mRNA transcript.


What would the complementary strand for cttaggcttacca?

The complementary strand for cttaggcttacca would be gaatccgaatggt. This is formed by pairing adenine with thymine and cytosine with guanine on the opposite strand.


Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?

Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.


What is the complementary DNA?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.