0
RNA has sub-division such as m-RNA(messanger RNA) which i learned it conducts a copy of the genetic information (in other words it makes a copy of DNA because DNA cannot go out of the NUCLEUS)
Wiki User
∙ 15y ago
Wiki User
∙ 14y agoI believe that it comes from polymerase I, which localizes in the nucleolus, and synthesizes rRNA. The multiple eukaryotic RNA polymerasis apparently originated through duplication of primordial subunit genes, followed by evolution of specialized functions.
Wiki User
∙ 9y agoRNA originally comes from DNA. More specifically, it comes from enzymes that DNA transcribes that are known as RNA polymerases.
Wiki User
∙ 14y agoIn the cell nucleus.
Add your answer:
Earn +20 pts
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA Polymerase
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
What is a single strand of rna that loops back on itself?
Transfer RNA (tRNA) is a single strand that loops back on itself.
Is DNA or RNA triple stranded?
DNA is generally double stranded and RNA is single stranded.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes. The strand of RNA is messenger RNA, mRNA.
What molecule builds the new strand of RNA during transcription?
RNA Polymerase plays the largest role in unzipping the DNA strand and then synthesizing the RNA strand.
Is influenza single strand or double strand RNA?
It is single stranded RNA. Importantly, it is also a segmented genome that allows it to have large genetic diversity.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
RNA Polymerase is the enzyme responsible for creating a strand of RNA.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
Is DNA a single strand of nucleotides?
No, DNA, from difference with the RNA, is a double strand of nucleotides. DNA, double strand (hence the double helix nickname). RNA, single strand.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA Polymerase
What RNA strand is produced from DNA?
messenger RNA (mRNA)
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What is a single strand of rna that loops back on itself?
Transfer RNA (tRNA) is a single strand that loops back on itself.
