0
invented the radioscope
Wiki User
∙ 8y ago
Add your answer:
Earn +20 pts
Who was Filomena F Campos?
she is a scientist. she is a plant breeding/cytogenetics
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
What had paulo c campos invented?
Nuclear medicine
When was Paulo Campos born?
Paulo Campos was born on 1921-07-27.
When was Paulo Ricardo Gomez Campos born?
Paulo Ricardo Gomes Campos was born on 1986-03-03.
When was Paulo Miguel Campos de Sousa born?
Paulo Miguel Campos de Sousa was born in 1980.
When did Ayres Campos die?
Ayres Campos died on July 6, 2003, in So Paulo, So Paulo, Brazil.
When was Cidinha Campos born?
Cidinha Campos was born on September 5, 1942, in So Paulo, So Paulo, Brazil.
Who is Paulo Campos?
invented the radioscope
When was São Paulo dos Campos de Piratininga created?
São Paulo dos Campos de Piratininga was created in 1554.
When was Haroldo de Campos born?
Haroldo de Campos was born on August 19, 1929, in So Paulo, So Paulo, Brazil.
When was Paulo Mendes Campos born?
Paulo Mendes Campos was born on February 28, 1922, in Belo Horizonte, Minas Gerais, Brazil.
What is the birth name of Paulo Silvino?
Paulo Silvino's birth name is Paulo Ricardo Campos Silvino.
Who established the first Radioisotope Laboratory in the Philippines?
Paulo C. Campos initiated the construction of the first radioisotope laboratory in the Philippines.
