0
A trand of DNA has the following order of bases CGTAtcga corresponding order of bases in the matching or Rna will be?
The corresponding order of bases in the matching RNA will be CGUAUGCU, as RNA uses uracil (U) instead of thymine (T). Therefore, each adenine (A) in DNA pairs with uracil (U) in RNA, while cytosine (C), guanine (G), and thymine (T) pair with guanine (G), cytosine (C), and adenine (A) respectively.
What else can I help you with?
What order of nitrogen bases would be in the matching lagging strand?
To determine the order of nitrogen bases in the matching lagging strand, you first need to know the sequence of the leading strand. The lagging strand is synthesized in short segments (Okazaki fragments) and runs in the opposite direction of the leading strand. If, for example, the leading strand has the sequence A-T-C-G-A, the corresponding order of nitrogen bases in the lagging strand would be T-A-G-C-T, as adenine pairs with thymine and cytosine pairs with guanine.
Is it true that transfer RNA attaches to the messenger RNA and reads the message by matching up with three-letter codes of bases?
Yes, it is true. Transfer RNA (tRNA) attaches to messenger RNA (mRNA) during translation, where it reads the genetic code by matching its anticodon with the corresponding three-letter codon on the mRNA. Each tRNA carries a specific amino acid that corresponds to the codon it recognizes, facilitating the assembly of proteins based on the mRNA sequence. This process is essential for translating the genetic information into functional proteins.
How many guanine bases a length of DNA will have if it has 26 cytosine bases?
In a double-stranded DNA molecule, the bases pair specifically: adenine pairs with thymine, and guanine pairs with cytosine. This means that for every cytosine base, there is a corresponding guanine base. Therefore, if there are 26 cytosine bases in the DNA, there will also be 26 guanine bases.
How many bases are in an anti-codon?
3 bases make up an anti-codon, 3 bases also make up a codon
What is a matching strand of DNA compared to AGTAAC?
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
What is a strand of DNA that has CGTATCGA. The corresponding order of bases in the matching RNA?
UAGGCAG is the base sequence
What isAnother form of RNA called matches amino acids with the bases on the messenger RNA?
Transfer RNA (tRNA) is responsible for matching amino acids with the bases on messenger RNA during protein synthesis. Each tRNA molecule carries a specific amino acid and has an anticodon region that recognizes and pairs with the corresponding codon on the mRNA.
What order of nitrogen bases would be in the matching lagging strand?
To determine the order of nitrogen bases in the matching lagging strand, you first need to know the sequence of the leading strand. The lagging strand is synthesized in short segments (Okazaki fragments) and runs in the opposite direction of the leading strand. If, for example, the leading strand has the sequence A-T-C-G-A, the corresponding order of nitrogen bases in the lagging strand would be T-A-G-C-T, as adenine pairs with thymine and cytosine pairs with guanine.
How do the nitrogen bases pair up during replication?
By forming matching hydrogen bonds.
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
How many bases are in a hexagonal pri?
A hexagonal prism has two bases, both of which are hexagonal in shape. The prism extends vertically between these two hexagonal bases. In total, it has six rectangular lateral faces connecting the corresponding sides of the bases.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What are the bases of mRNA coded for by this section of DNA before the mutation?
The bases of mRNA coded for by a DNA segment are complementary to the original DNA sequence. If the DNA sequences are ATCG, the corresponding mRNA bases will be UAGC.
How many vertical lines does a triangular prism have?
A triangular prism has three vertical lines, corresponding to the three edges of its triangular bases. Additionally, it has three vertical edges connecting the corresponding vertices of the two triangular bases. Therefore, in total, a triangular prism has six vertical lines.
What is the shape of the bases for the following polyhedron?
It would help if the "following" did actually follow!
What does computer forensics use computer systems and technology for?
Mainly matching date from a particular crime with data in large data bases.
Is it true that transfer RNA attaches to the messenger RNA and reads the message by matching up with three-letter codes of bases?
Yes, it is true. Transfer RNA (tRNA) attaches to messenger RNA (mRNA) during translation, where it reads the genetic code by matching its anticodon with the corresponding three-letter codon on the mRNA. Each tRNA carries a specific amino acid that corresponds to the codon it recognizes, facilitating the assembly of proteins based on the mRNA sequence. This process is essential for translating the genetic information into functional proteins.
