0
What else can I help you with?
What is a matching strand of DNA compared to AGTAAC?
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
What is the function of one strand in the double helix structure during DNA replication?
During DNA replication, one strand of the double helix serves as the template for synthesizing a new complementary strand. The enzyme DNA polymerase reads the template strand and adds nucleotides one by one, matching them with the appropriate bases (adenine with thymine, and cytosine with guanine). This process ensures that the genetic information is accurately copied and passed on to the daughter cells. The other strand, known as the lagging strand, is synthesized in short segments, which are later joined together.
What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?
The lagging strand of DNA is replicated using a process called Okazaki fragments. These are short DNA fragments synthesized in the 5' to 3' direction by DNA polymerase, and are subsequently joined together by DNA ligase to form a continuous strand.
What rungs of DNA ladder made up of?
The rungs of DNA are made up of the nitrogenous bases Adenine (A), Cytosine (C), Guanine (G) and Thymine (T). Each rung represents the bonding of two bases (one from each DNA strand). A binds with T and C binds with G.
What are the nitrogen bases found on mrna?
The nitrogen bases found on mRNA are adenine (A), cytosine (C), guanine (G), and uracil (U). These bases are used during transcription to create the mRNA molecule by complementary base pairing with the DNA template strand.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
What is a matching strand of DNA compared to AGTAAC?
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
What is the function of one strand in the double helix structure during DNA replication?
During DNA replication, one strand of the double helix serves as the template for synthesizing a new complementary strand. The enzyme DNA polymerase reads the template strand and adds nucleotides one by one, matching them with the appropriate bases (adenine with thymine, and cytosine with guanine). This process ensures that the genetic information is accurately copied and passed on to the daughter cells. The other strand, known as the lagging strand, is synthesized in short segments, which are later joined together.
How do the nitrogen bases pair up during replication?
By forming matching hydrogen bonds.
Two of the four nitrogen bases linked together in each double strand of DNA?
RNA
What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?
The enzyme responsible for placing the corresponding nitrogen bases on the new strand of DNA is called DNA polymerase. DNA polymerase is essential for DNA replication as it helps add nucleotides to the growing DNA strand according to the sequence of the template strand.
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?
The lagging strand of DNA is replicated using a process called Okazaki fragments. These are short DNA fragments synthesized in the 5' to 3' direction by DNA polymerase, and are subsequently joined together by DNA ligase to form a continuous strand.
How does the pairing of the nitrogen bases in DNA molecule make sure that a replicated strand is exactly the same as the original strand?
The complimentary pairing of the two strands of DNA with their nitrogen-containing bases allows them to make exact copies. Each one matches up with another exactly to make the "blue print" of the cell.
Key feature that allows DNA to be copied?
The key feature that allows DNA to be copied is its double-stranded helical structure, where the two strands are complementary to each other. During replication, enzymes called DNA polymerases read the existing strand to create a new complementary strand by matching bases (A with T, and C with G). This process ensures that each new DNA molecule contains the same genetic information as the original one.
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
