answersLogoWhite

0

To determine the order of nitrogen bases in the matching lagging strand, you first need to know the sequence of the leading strand. The lagging strand is synthesized in short segments (Okazaki fragments) and runs in the opposite direction of the leading strand. If, for example, the leading strand has the sequence A-T-C-G-A, the corresponding order of nitrogen bases in the lagging strand would be T-A-G-C-T, as adenine pairs with thymine and cytosine pairs with guanine.

User Avatar

AnswerBot

1mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


What is the function of one strand in the double helix structure during DNA replication?

During DNA replication, one strand of the double helix serves as the template for synthesizing a new complementary strand. The enzyme DNA polymerase reads the template strand and adds nucleotides one by one, matching them with the appropriate bases (adenine with thymine, and cytosine with guanine). This process ensures that the genetic information is accurately copied and passed on to the daughter cells. The other strand, known as the lagging strand, is synthesized in short segments, which are later joined together.


What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?

The lagging strand of DNA is replicated using a process called Okazaki fragments. These are short DNA fragments synthesized in the 5' to 3' direction by DNA polymerase, and are subsequently joined together by DNA ligase to form a continuous strand.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


How do the nitrogen bases of RNA match up with the bases of DNA during transcription?

During transcription, the nitrogen bases of RNA match up with the bases of DNA through complementary base pairing. Adenine (A) in DNA pairs with uracil (U) in RNA, while cytosine (C) in DNA pairs with guanine (G) in RNA. This pairing occurs as RNA polymerase synthesizes a single strand of RNA using the DNA template strand. The result is a complementary RNA strand that reflects the genetic code carried by the DNA.

Related Questions

During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?

gaucgaucacucaggacuaug


What bases would match up to form a matching DNA strand from this pattern?

A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.


What is a matching strand of DNA compared to AGTAAC?

A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.


What is the function of one strand in the double helix structure during DNA replication?

During DNA replication, one strand of the double helix serves as the template for synthesizing a new complementary strand. The enzyme DNA polymerase reads the template strand and adds nucleotides one by one, matching them with the appropriate bases (adenine with thymine, and cytosine with guanine). This process ensures that the genetic information is accurately copied and passed on to the daughter cells. The other strand, known as the lagging strand, is synthesized in short segments, which are later joined together.


How do the nitrogen bases pair up during replication?

By forming matching hydrogen bonds.


Two of the four nitrogen bases linked together in each double strand of DNA?

RNA


What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?

The enzyme responsible for placing the corresponding nitrogen bases on the new strand of DNA is called DNA polymerase. DNA polymerase is essential for DNA replication as it helps add nucleotides to the growing DNA strand according to the sequence of the template strand.


If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?

the complimentary styrand would be: T-C-C-G-A-T


What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?

The lagging strand of DNA is replicated using a process called Okazaki fragments. These are short DNA fragments synthesized in the 5' to 3' direction by DNA polymerase, and are subsequently joined together by DNA ligase to form a continuous strand.


What is the matching DNA strand called?

The matching DNA strand is called the complementary strand. In DNA, the bases pair specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). This complementary base pairing is essential for the structure of DNA and plays a crucial role in processes like DNA replication and transcription.


How does the pairing of the nitrogen bases in DNA molecule make sure that a replicated strand is exactly the same as the original strand?

The complimentary pairing of the two strands of DNA with their nitrogen-containing bases allows them to make exact copies. Each one matches up with another exactly to make the "blue print" of the cell.


How do the nitrogen bases of RNA match up with the bases of DNA during transcription?

During transcription, the nitrogen bases of RNA match up with the bases of DNA through complementary base pairing. Adenine (A) in DNA pairs with uracil (U) in RNA, while cytosine (C) in DNA pairs with guanine (G) in RNA. This pairing occurs as RNA polymerase synthesizes a single strand of RNA using the DNA template strand. The result is a complementary RNA strand that reflects the genetic code carried by the DNA.