0
What else can I help you with?
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
What complentary strand of DNA would be produced from the straind of DNA shown below?
To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.
If one strand of RNA has the sequence aattgcttacc what will the sequence of the second strand be?
It's not ACCTGGAT.I think it might be TGGACCTA.you are wrong.. it IS ACCTGGAT
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
How do you calculate the tmfvalue?
The melting temperature TM, characterises the stability of the DNA hybrid formed between an oligonucleotide and its complementary strand. At TM 50% a given oligonucleotide can hybridised to its complementary strand. By: Zoya Mobeen
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What would be the strand of complementary DNA produce by the strand of DNA tcg aag?
Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
The complementary strand for the given DNA sequence cttaggcttacca is gaatccgaatggt. This is obtained by pairing cytosine with guanine, thymine with adenine, adenine with thymine, and guanine with cytosine.
If one strand of RNA has the sequence aattgcttacc what will the sequence of the second strand be?
It's not ACCTGGAT.I think it might be TGGACCTA.you are wrong.. it IS ACCTGGAT
How do you find a complimentry strand of DNA?
DNA usually comes in a double stranded helix, but if there is only one strand provided, complimentary base pairing occurs. Adenine and Thymine pair, as do Guanine and Cytosine. Given a sequence of DNA, using this, you can find its complementary strand.
How do you write the complementary strand and mRNA strand for atggacaaactcaactca?
comp : tacctgtttgagttgagt mrna : uaccuguuugaguugagu For comp: just go opposite, c is opposite of g, and a is opposite of t For Mrna: do the same except when you would have a t(thymine) make it a u(uracil) since mrna doesnt have any thymine in it.
