0
What else can I help you with?
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What is the base sequence on the other strand?
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
Which sequence of DNA bases would pair with the one shown in the partial strand below?
To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.
What is the base sequence for a DNA strand when given the sequence for a mRNA strand?
To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
What is the base sequence on the other strand?
To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.
Which sequence of DNA bases would pair with the one shown in the partial strand below?
To determine the complementary DNA base sequence for a given strand, you need to know the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the specific sequence of the partial DNA strand, I can help you identify the complementary bases that would pair with it.
What is the base sequence for a DNA strand when given the sequence for a mRNA strand?
To determine the base sequence of a DNA strand from a given mRNA sequence, you need to consider that mRNA is synthesized from the DNA template strand through a process called transcription. The mRNA bases pair with their complementary DNA bases, where adenine (A) pairs with thymine (T), uracil (U) in mRNA pairs with adenine (A) in DNA, cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). Therefore, to find the DNA base sequence, you can convert the mRNA sequence to its corresponding DNA sequence by replacing U with A and reversing the order to get the complementary DNA strand.
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
How do you calculate the tmfvalue?
The melting temperature TM, characterises the stability of the DNA hybrid formed between an oligonucleotide and its complementary strand. At TM 50% a given oligonucleotide can hybridised to its complementary strand. By: Zoya Mobeen
What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?
The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.
Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?
The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.
What complentary strand of DNA would be produced from the straind of DNA shown below?
To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.
In this strand of DNA was used that would be the complementary DNA Produced?
To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
