0
What else can I help you with?
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the corresponding sequence of t-a-c-a-a-c-g-t-g?
It will be based on the process in which it involved- for replication, transcription or translation As a rule the bases will be expressed in Capital letters If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil Sreekala.K.P
How do you rewrite the sequance a-c-t-g-g-a-t to show a insertion of a nucleotide in the DNA strand?
To show an insertion of a nucleotide (say "c") in the sequence "a-c-t-g-g-a-t", you would write it as "a-c-t-c-g-g-a-t". The inserted nucleotide "c" fits in between the existing nucleotides "t" and "g".
How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.
What tetrapeptide is synthesized from the informational DNA sequence G-T-C-A-G-T-A-C-G-T-T-A?
Ala-Gln-Pro-Asn
What is the importance of the ratios A to T and G to C to the structure of DNA?
The ratios A to T and G to C are very important to the structure of DNA. A or Adenie only bonds with T or Thymine so there are almost always equal numbers in the structure. This is also true with C or cytosine and G or guanine.
What is. equivalent ratios ratios?
Two ratios, R:S and T:U are equivalent if R/S = T/U. Another way of expressing that relationship is R*U = S*T.
What is the amino acid for t a c g c g c c t a g g g g g t g g?
A t g t g g a a c c g t g
What are T and Cs?
In my industry, they are know as terms and conditions.
Write a program to generate CRC?
/*written by: Bibhakar Jha;objective : to implement CRC in c programming language;*///Program code to add CRC check bit#include#include#define N strlen(g)char t[28],cs[28],g[]="10001000000100001";int a,e,c;void xor(){for(c = 1;c < N; c++)cs[c] = (( cs[c] == g[c])?'0':'1');}void crc(){for(e=0;e
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
How many Cs atoms are there in a 53.7 gram sample of Cs?
This is a two-step calculation. First convert grams Cs to moles Cs. Then convert moles Cs to atoms Cs.The atomic weight of cesium is 133 g/mol1. To convert grams to moles:moles Cs= 53.7 g Cs1 mol = 0.404 mol Cs133 gMultiply by moles per gram. Grams cancel out.2. To convert moles to atoms:atoms Cs = 0.404 mol Cs6.02 x 1023 atoms = 2.43E+23 atoms CsmolMultiply by atoms/mole. Moles cancel out.
