answersLogoWhite

0

I have no clue as to what this question means?

User Avatar

Wiki User

13y ago

What else can I help you with?

Continue Learning about Natural Sciences

What is the molar mass of Cs2?

The molar mass of cesium (Cs) is approximately 132.91 g/mol. Since the chemical formula Cs₂ indicates there are two cesium atoms, the molar mass of Cs₂ is calculated as 2 × 132.91 g/mol, which equals approximately 265.82 g/mol.


What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?

It's GTTCATCCGA


What is the corresponding sequence of t-a-c-a-a-c-g-t-g?

It will be based on the process in which it involved- for replication, transcription or translation As a rule the bases will be expressed in Capital letters If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil Sreekala.K.P


How do you rewrite the sequance a-c-t-g-g-a-t to show a insertion of a nucleotide in the DNA strand?

To show an insertion of a nucleotide (say "c") in the sequence "a-c-t-g-g-a-t", you would write it as "a-c-t-c-g-g-a-t". The inserted nucleotide "c" fits in between the existing nucleotides "t" and "g".


How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?

To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.

Related Questions

What is the importance of the ratios A to T and G to C to the structure of DNA?

The ratios A to T and G to C are very important to the structure of DNA. A or Adenie only bonds with T or Thymine so there are almost always equal numbers in the structure. This is also true with C or cytosine and G or guanine.


What is. equivalent ratios ratios?

Two ratios, R:S and T:U are equivalent if R/S = T/U. Another way of expressing that relationship is R*U = S*T.


What is the amino acid for t a c g c g c c t a g g g g g t g g?

A t g t g g a a c c g t g


What is the molar mass of Cs2?

The molar mass of cesium (Cs) is approximately 132.91 g/mol. Since the chemical formula Cs₂ indicates there are two cesium atoms, the molar mass of Cs₂ is calculated as 2 × 132.91 g/mol, which equals approximately 265.82 g/mol.


Write a program to generate CRC?

/*written by: Bibhakar Jha;objective : to implement CRC in c programming language;*///Program code to add CRC check bit#include#include#define N strlen(g)char t[28],cs[28],g[]="10001000000100001";int a,e,c;void xor(){for(c = 1;c < N; c++)cs[c] = (( cs[c] == g[c])?'0':'1');}void crc(){for(e=0;e


What are T and Cs?

In my industry, they are know as terms and conditions.


What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?

It's GTTCATCCGA


What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?

The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.


What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?

The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.


Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?

In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.


What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?

Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A


What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?

G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine