I have no clue as to what this question means?
The molar mass of cesium (Cs) is approximately 132.91 g/mol. Since the chemical formula Cs₂ indicates there are two cesium atoms, the molar mass of Cs₂ is calculated as 2 × 132.91 g/mol, which equals approximately 265.82 g/mol.
It's GTTCATCCGA
It will be based on the process in which it involved- for replication, transcription or translation As a rule the bases will be expressed in Capital letters If it is replication the sequence will A-T-G-T-T-G-G-A-C as the components of DNA is Adenine,Guianine, cytosine and thymine But if it is for transcription it will be A-U-G-U-U-G-G-A-C as in RNA thymine is replace by uracil Sreekala.K.P
To show an insertion of a nucleotide (say "c") in the sequence "a-c-t-g-g-a-t", you would write it as "a-c-t-c-g-g-a-t". The inserted nucleotide "c" fits in between the existing nucleotides "t" and "g".
To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.
The ratios A to T and G to C are very important to the structure of DNA. A or Adenie only bonds with T or Thymine so there are almost always equal numbers in the structure. This is also true with C or cytosine and G or guanine.
Two ratios, R:S and T:U are equivalent if R/S = T/U. Another way of expressing that relationship is R*U = S*T.
A t g t g g a a c c g t g
The molar mass of cesium (Cs) is approximately 132.91 g/mol. Since the chemical formula Cs₂ indicates there are two cesium atoms, the molar mass of Cs₂ is calculated as 2 × 132.91 g/mol, which equals approximately 265.82 g/mol.
/*written by: Bibhakar Jha;objective : to implement CRC in c programming language;*///Program code to add CRC check bit#include#include#define N strlen(g)char t[28],cs[28],g[]="10001000000100001";int a,e,c;void xor(){for(c = 1;c < N; c++)cs[c] = (( cs[c] == g[c])?'0':'1');}void crc(){for(e=0;e
In my industry, they are know as terms and conditions.
It's GTTCATCCGA
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine