0
What else can I help you with?
If this CGA CT strand of DNA was used what would be the complementry DNA produced?
The complementary DNA strand to the CGA CT strand would be GCT AG. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
If this strand of DNA was used what would be the complementary DNA produced CGA CT A. TAG TC B. CGA CT C. GCG GA D. GCT GA?
The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Given the DNA strand CGA CT A, the complementary sequence would be GCT GA T. Among the options provided, the closest match is D. GCT GA.
F this strand of DNA was used what would be the complementary DNA produced CGA CT?
To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."
How can you complete the complementary strand for the base sequence acg tag gct tca gct?
TGC ATC CGA AGT CGA
What does the complimentary strand look like for ccc-cga-ata?
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
What strand of mrna would be produced from the strand of DNA shown below gct aag?
GCT AAG would produce the strand of mRNA of "CGA UUC" CGU AAU UGA CUG
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
F this strand of DNA was used what would be the complementary DNA produced CGA CT?
To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."
If this strand of DNA were used what would be the complementary DNA produced CGA CT?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
How can you complete the complementary strand for the base sequence acg tag gct tca gct?
TGC ATC CGA AGT CGA
Which dna strand is complementary to cga atc agc?
Gct tag tcg
What does the complimentary strand look like for ccc-cga-ata?
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
Which strand of mrna would be made during transcription using the dna strand gat ccg?
Ucg cga GAC UAU
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
If this stand of DNA was used, what would be the complementary DNA produced CGA CT?
GCT GA :)
