0
What else can I help you with?
What enzyme is responsible for decodingthe DNA strand into an mRNA?
The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.
What molecule builds the new strand of RNA during transcription?
RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
What connects Rna nucleotides to dNA during transcription?
During transcription, RNA polymerase catalyzes the synthesis of an RNA molecule by base-pairing complementary RNA nucleotides with the DNA template strand. This complementary base pairing allows the RNA nucleotides to be connected to the DNA template, forming a growing strand of RNA that is identical in sequence to the non-template DNA strand.
When is uracil used in DNA?
No, it is not found in DNA, thought it is found in RNA.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What strand of DNA does RNA polymerase use during transcription?
During transcription, RNA polymerase uses the template strand of DNA to create a complementary RNA strand.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Is transcription the manufacture of a strand of RNA complementary to a strand of DNA?
Yes, that's correct. Transcription is the process by which the genetic information in a segment of DNA is used to create a complementary RNA strand. This RNA molecule can then be used to direct the synthesis of proteins in a cell.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.
What molecule builds the new strand of RNA during transcription?
RNA polymerase builds the new strand of RNA during transcription. It catalyzes the formation of phosphodiester bonds between nucleotides to create the complementary RNA strand based on the DNA template strand.
What is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA?
RNA polymerase is the enzyme that uses one strand of DNA as a template to assemble nucleotides into a strand of RNA during transcription.
What RNA strand is produced from DNA?
messenger RNA (mRNA)
What is the process by which a molecule of DNA is copied into a strand of RNA occurs where?
The process by which a molecule of DNA is copied into a strand of RNA is called transcription. It occurs in the nucleus of a cell and involves the enzyme RNA polymerase, which reads one strand of the DNA molecule and synthesizes a complementary RNA strand. This new RNA molecule then serves as a template for protein synthesis.
Why is RNA needed to create proteins?
RNA is a single-stranded structure that is copied from an unzipped DNA strand identically, this is called transcription. The RNA strand contains the complementary base pairs for the DNA sequence. The DNA strand has sections that code for specific proteins, so when the RNA strand is created from the DNA, the RNA strand is then able to recreate the sequence that codes for the proteins. The RNA strand leaves the nucleus, via a nuclear pore, and enters the cytoplasm. In the cytoplasm the RNA strand binds to two Ribosomal subunits, and translation is carried out, producing proteins.
What must happen to a DNA molecule before RNA ploymerase can make RNA?
The double strand helix is opened by enzymes called helicase and this allow the RNA polymerase to copy the DNA strand. The double strand helix is opened by enzymes called helicase and this allow the RNA polymerase to copy the DNA strand.
What connects Rna nucleotides to dNA during transcription?
During transcription, RNA polymerase catalyzes the synthesis of an RNA molecule by base-pairing complementary RNA nucleotides with the DNA template strand. This complementary base pairing allows the RNA nucleotides to be connected to the DNA template, forming a growing strand of RNA that is identical in sequence to the non-template DNA strand.
