0
In DNA, complementary strands are two strands of nucleotides that base pair by hydrogen bonds across the nitrogen basses of each nucleotide is such a way that A (adenine) always pairs with T (thymine) and G (guanine) always pairs with C (cytosine). The sequences are complementary in that each strand has the pair match (complimentary) base to the other all along the strand.
Dr. Claire
DNA Diva
Wiki User
∙ 13y ago
Wiki User
∙ 9y agoThe best way to do this in duplication of the DNA. AT and CG are complimentary to each other. So to adenine you fix the thymine and vise verse. To cytosine you fix the guanine and vise verse. You can not make a mistake or make one, very rarely.
Add your answer:
Earn +20 pts
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
WHAT IS THE COMPLIMENTARY STRAND TO TTAGCGGCAAT?
AATCGCCGTTA
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
The complimentary strand or matchig strand of DNA for tagtca would be?
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
DNA strand that would replicate tcgagaatctcgatt?
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
What is the complementarty strand for 5' ttacgggtccagtcatgcga 3'?
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
What compliments TACGTT?
The complimentary DNA strand is ----> ATGCAA
What is the complimentary strand of GTA-GCA?
acg-att
What is the complementary sequence of bases in the strand of DNA AACCCTGAGTCT?
taacgggtac
When the DNA strand splits into two what are these two said to be A. Coded B. Complimentary C. Concise D. Contradictory?
B. Complimentary
Is a newly synthesized strand half of the original stand with newly formed complimentary half?
yep. the new double strand is one of the original strands and a new strand
If a DNA strand had the sequence CCGAGATTG what is the nucloetide sequence of the complimentary strand?
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?
A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.
