0
A search for sequences that are complementary to the desired sequence of a DNA fragment uses a technique called?
Wiki User
∙ 12y ago
Hybridization
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
Are the two Double Helix the same?
no both the double helices aren't the same. the sequences(bases) that are part of one of the helix is sequence complementary to the other strand of DNA.structurally they form the helical pattern, the sequence information is absolutely different.this itself determines the specificity,
What is it called when copying part of a nucleotide sequence of dna into a complementary sequence in rna?
transcription
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
Which base sequence in DNA is complementary to the base sequence atgt?
ATAGCC is complementary to the base sequence TATCGG.
What sequence is complementary to aggtac?
The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What is complementary sequence?
When DNA and/or RNA are in the double helix configuration each helix is the complementary sequence of the other.
What sequence is the sequence of the complementary strand of DNA?
its tcaa
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
What is the sequence of complementary strand?
TGCA
If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?
auc
How many memory sequences are in assassin's creed 3?
There are 9 memory sequences in Assassin's Creed: Brotherhood. Sequence 1: Peace At Last, Sequence 2: A Wilderness of Tigers, Sequence 3: The Fighter, The Lover and The Thief, Sequence 4: Den of Thieves, Sequence 5: The Banker, Sequence 6: The Baron De Valios, Sequence 7: The Key to Castello, Sequence 8: The Borgia, Sequence 9: The Fall
What is the next number in the series below 3 16 6 12 12 8?
You could consult the Online Encyclopedia of Integer Sequences, but it does not have this sequence. http://www.research.att.com/~njas/sequences/ Note: the mathematical term "series" refers to a sum. The series is 3 + 16 + 6 +... In mathematics, a list of numbers like that is referred to as a "sequence." Also, while your question does not explicity state this, the meaning of your sentence should be "what is the next most likely number..." as many different sequences start out with the same terms. Try checking 1,2,3, at the OEIS, and you'll see a large number of possibilities for the 4th term. However, to address your particular sequence, here's a technique that is sometimes used: Consider the following two sequences: 1,2,3,4,5,6,7... 5,10,15,20,25,... Now consider the sequence 1,5,2,10,3,15,4,20,... If you work your sequence backwards, you'll see that this technique will lead to a possible answer.
What would be the base sequence of the complementary mRNA strand?
TGCA
What is sequence in probability?
There is no relationship between sequences and probability.
