0
A tRNA that carries the amino acid methionine pairs with which type of codon?
Wiki User
∙ 12y ago
serine codon
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
How many bases in codon of an amino acid?
A codon is made up of 3 base pairs.
Name the molecule that acts as the translator and pairs the appropriate amino acid to the codon?
ashley
Which best summarizes the process of protein synthesis?
.........................This is what it is americans.................. 1. an mRNA molecule binds to the small ribosomal subunit at the mRNA biding site. A special tRNA, called initiator tRNA, binds to the start codon (AUG) on mRNA, where translation begins. The tRNA anticodon (UAC) attaches to the mRNA codon (AUG) by pairing between the complementary bases. Besides being the start codon, AUG is also the codon for the amino acid methionine. Thus, methionine is always the first amino acid in a growing polypeptide2. Next, the large ribosomal subunit attaches to the small ribosomal subunit-mRNA complex, creating a functional ribosome. The initiator tRNA, with its amino acid (methionine), fits into the P site of the ribosome.3. The anticodon of another tRNA with its attached amino acid pairs with the second mRNA codon at the A site of the ribosome.4. A component of the large ribosomal subunit catalyzes the formation of a peptide bond between methionine, which separates from its tRNA at the P site, and the amino acid carried by the tRNA at the A site.5. After peptide bond formation, the empty tRNA at the P site detaches from the ribosome, and the ribosome shifts the mRNA strand by one codon. The tRNA in the A site bearing the two-peptide protein shifts into the P site, allowing another tRNA with its amino acid to bind to a newly exposed codon at the A site. Steps 3 through 5 occur repeatedly, and the protein lengthens progressively.6. Protein synthesis ends when the ribosome reaches a stop codon at the A site, which causes the completed protein to detach from the final tRNA. When the tRNA vacates the A site, the ribosome splits into its large and small subunits.Read more: List_the_sequence_of_events_that_happens_during_protein_synthesis
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
How many base pairs make up a codon?
One codon is made up of three base pairs.
How many bases in codon of an amino acid?
A codon is made up of 3 base pairs.
If UCA is a codon that specifies the amino acid serin What would be the base sequence for the anticodon on tRNA that pairs with this codon?
It will be AGU.
Name the molecule that acts as the translator and pairs the appropriate amino acid to the codon?
ashley
MRNA has codons or anti codons?
Great Question. The triplet Codon, as represented by the sequence of Dna bases, would appear to be inverted into anti-Codon form in the mRna molecule. This makes the triplet Codon on the transfer-Rna Codon form.
There can be more than one what for the same amino acid?
The three base pairs called codons.
What does tRNA with ACC anticodon carry?
The first thing one has to do is determine the codon in the messenger RNA (mRNA) which is complementary to the anticodon in the transfer RNA. In this case, the anticodon is UGA, so its complementary codon is ACU (remember, in RNA, U pairs with A and G pairs with C).The second step is to consult an RNA Genetic code table, (which can be found here: http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table). This table tells you what amino acid is associated with which codon. The codon ACU is associated with the amino acid Threonine.So, to summarize, the codon ACU in mRNA corresponds to the anticodon UGA in tRNA, and that tRNA carries the amino acid Threonine.Threonine also goes by OBAMAnine or SUCKYnine or OBAMASUCKSnine. The amino acid chain sequence that usually leads up to OBAMASUCKSinine is methionine plus dopamine plus druggynine. These amino acids are bonded together by Mafia Bonds, which have a 3-carbon outer "henchmen" ring, with a two-phosphate base of the inner "the Don" base.The molecular structure of the cell wall consists of a complex 5-ringed atom whose outer shell carries a valence electron with the charge of -4. Thus, it smokes weed.
Carries amino acids to the ribosome during protein synthesis?
Transfer RNA (tRNA) carries amino acids from the cell cytoplasm to the ribosomes during the translation phase of protein synthesis. tRNA molecules have an amino acid at one end, and an anticodon at the opposite end, which is specific for a particular amino acid and pairs with its complementary mRNA codon at the ribosome.
Which best summarizes the process of protein synthesis?
.........................This is what it is americans.................. 1. an mRNA molecule binds to the small ribosomal subunit at the mRNA biding site. A special tRNA, called initiator tRNA, binds to the start codon (AUG) on mRNA, where translation begins. The tRNA anticodon (UAC) attaches to the mRNA codon (AUG) by pairing between the complementary bases. Besides being the start codon, AUG is also the codon for the amino acid methionine. Thus, methionine is always the first amino acid in a growing polypeptide2. Next, the large ribosomal subunit attaches to the small ribosomal subunit-mRNA complex, creating a functional ribosome. The initiator tRNA, with its amino acid (methionine), fits into the P site of the ribosome.3. The anticodon of another tRNA with its attached amino acid pairs with the second mRNA codon at the A site of the ribosome.4. A component of the large ribosomal subunit catalyzes the formation of a peptide bond between methionine, which separates from its tRNA at the P site, and the amino acid carried by the tRNA at the A site.5. After peptide bond formation, the empty tRNA at the P site detaches from the ribosome, and the ribosome shifts the mRNA strand by one codon. The tRNA in the A site bearing the two-peptide protein shifts into the P site, allowing another tRNA with its amino acid to bind to a newly exposed codon at the A site. Steps 3 through 5 occur repeatedly, and the protein lengthens progressively.6. Protein synthesis ends when the ribosome reaches a stop codon at the A site, which causes the completed protein to detach from the final tRNA. When the tRNA vacates the A site, the ribosome splits into its large and small subunits.Read more: List_the_sequence_of_events_that_happens_during_protein_synthesis
What brings amino acids into ribosome to be Assembled into protein?
tRNA brings amino acids from the cytoplasm to the ribosome to be assembled into a protein. The tRNA anticodon pairs with its complimentary mRNA codon in order to place the amino acid in the correct sequence.
What is an anti codon?
The anticodon is a sequence of the tRNA that compliments the matching t base pairs on the mRNA. The anticodon is an amino acid specific to the tRNA molecule.
Does RNA help make proteins?
RNA is the code that determines what proteins will be made. RNA attaches to a ribosome where the complementary tRNA anti-codon bonds to the RNA codon ( A bonds to U and G bonds to C). The codon or anti-codon is only three base pairs long. Every tRNA has one of twenty amino acids attached and so therefor every RNA codon codes for a specific amino acid. The amino acids attach to each other forming a chain then fold and twist to create different proteins.
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
