0
How does topoisomerase affect the DNA strand during DNA replication?
MaiBrooksgp6763
The topoisomerase enzyme uncoils the double helical structure of DNA during its replication to form the replication fork. In eukaryotes both posive and negative supercoils get unbind by topoisomerase I & II respectively.
Topoisomerase isomerase unwinds DNA to form replication fork
Wiki User
∙ 9y ago
Wiki User
∙ 9y agoThe topoisomerase enzyme uncoils the double helical structure of DNA during its replication to form the replication fork. In eukaryotes both posive and negative supercoils get unbind by topoisomerase I & II respectively.
Wiki User
∙ 9y agoTopoisomerase isomerase unwinds DNA to form replication fork
Add your answer:
Earn +20 pts
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
How many strands of DNA are used as templates during replication?
5'-3' : One strand
What are leading strands?
Leading strands are one of the two newly synthesized DNA strands during DNA replication. They are synthesized in a continuous manner in the 5' to 3' direction, following the replication fork. The leading strand is synthesized in the same direction as the replication fork is moving, allowing for continuous synthesis.
What is the DNA strand that is synthesized continuously during DNA replication?
leading strand
What enzyne produces a new DNA strand during DNA replication?
The DNA polymerase enzyme produces a new DNA strand during DNA replication
What is the role of topoisomerase II?
Topoisomerase: are isomerase enzymes that act on the topology of DNAHelicase untwists the double helix and separates the template DNA strands at the replication fork. This untwisting causes tighter twisting ahead of the replication fork, and topoisomerase helps relieve this strain
The continually elongating strand of new DNA at one side of a replication fork during replication is known as the?
Leading!
How many strands are replicated in DNA replication?
Two - the leading strand and the lagging strand.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
During dna replication each double helix produced consists of?
one parent strand and one new strand of DNA.
What enzymes produced a new DNA strand during DNA replication?
DNA Polymerase
There is a y shaped replication fork on each side of each replication bubble what are the sides of the replication fork called?
One is known as the Leading strand, and the other is known as the Lagging strand.
How many strands of DNA are used as templates during replication?
5'-3' : One strand
What is the definition of a lagging strand?
A lagging strand is one of two strands of DNA found at the replication fork, or junction, in the double helix; the other strand is called the leading strand. A lagging strand requires a slight delay before undergoing replication, and it must undergo replication discontinuously in small fragments.
What happens at the DNA replication fork?
The DNA replication fork is where the replication origin forms the Y shape. The replication fork moves down the DNA strand to the strand's end, resulting in every replication fork having a twin.
