0
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
Wiki User
∙ 13y ago
the complimentary styrand would be:
T-C-C-G-A-T
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
Which sequence of RNA bases with pair up with a strand of DNA bases that reads TACTGCA?
it would read: atgacgt
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is a characteristic of nucleic acids in which the sequence of bases on one strand is paired to the sequence of bases on the other?
Complementary Base- pairs
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
Which sequence of RNA bases with pair up with a strand of DNA bases that reads TACTGCA?
it would read: atgacgt
If the sequence of nucleotides of one strand of the two strands of DNA was known is it possible to use that information to determine the sequence of the second strand?
Yes because the bases pair uniquely when the strands are joined together.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
How many bases on a strand of mRNA code for one amino acid?
3 nucleotides
