the complimentary styrand would be:
T-C-C-G-A-T
If the other strand is DNA strand then it is T G C A G A C. If it is RNA then it is U G C A G A C.
it is GTTCA YEAH THAT IS CORRECT
G-T-T-C-A
TGGC
The corresponding mRNA strand would be AUCG.
The sequence on the strand of the helix is TACCGGATC.
THYMINE-ADENINE CYTOSINE-GUANINE
it would read: atgacgt
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
The corresponding mRNA strand would be AUCG.
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
The sequence would be GACGGT
Complementary Base- pairs
gaucgaucacucaggacuaug
The complimentary strand of MRNA would be AAUUCCGG.
The sequence on the strand of the helix is TACCGGATC.
THYMINE-ADENINE CYTOSINE-GUANINE
it would read: atgacgt
Yes because the bases pair uniquely when the strands are joined together.
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
3 nucleotides