0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Transpose a-t divided by b-t equals c so that t is the subject?
(a - t)/(b - t) = c => a - t = c(b - t) = cb - ct = bc - tc => tc - t = bc - a => t(c - 1) = bc - a => t = (bc - a)/(c - 1)
How write a c program to generate fibinocis series upto n turms?
int f1=1, f2=1, c=2; do { t=f1+f2; printf("%d\t",t); f1=f2; f2=t; c=c+1; }while(c
What does 1 C up a T mean?
1 C up a T probably means 1 cat up a tree.
Integration of tangent cubed of x?
Find I = ∫ tan³ x dx. The solution is: I = ½ tan² x - log cos x. * * * Here is how we can obtain this result: First, let t = tan x, s = sin x, and c = cos x; then, dI = t³ dx, ds = c dx, dc = -s dx, and dt = (1 + t²) dx; and, of course, t = s / c. By algebra, t³ = t(t² + 1) - t; thus, we have dI = t³ dx = t(t² + 1) dx - t dx = t dt - t dx. Now, d (t²) = 2t dt; thus, t dt = ½ d(t²). On the other hand, we have d log c = dc / c = -s dx / c = -t dx; thus, t dx = -d log c. Combining these results, we have dI = t dt - t dx = ½ d(t²) - d log c. This integrates readily, giving I = ½ t² - log c, which is the solution we sought. * * * We may check our result, by differentiating back: dt / dx = 1 + t²; and d(t²) / dt = 2t; thus, (d/dx)(t²) = 2t dt / dx = 2t (1 + t²). Also, we have d log c / dc = 1 / c; and dc / dx = -s; whence, (d/dx)(log c) = (dc / dx) / c = -s / c = -t. Then, dI / dx = ½ (d/dx)(t²) - (d/dx)(log c) = t (1 + t²) - t = t + t³ - t = t³, re-assuring us that we have integrated correctly.
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What are the release dates for W-I-T-C-H- - 2004 It Begins 1-1?
W-I-T-C-H- - 2004 It Begins 1-1 was released on: USA: 15 January 2005
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
How many base pairs are needed to code for 1 trait?
8 because say your letters are T,A,G,and C. T goes with A and then you flip it around and that makes A and T. G and C go together and if you flip that around its C and G. if you dont learn be reading here it is: T,A and A,T G,C and C,G
Suppose 1 strand of a DNA molecule contained the following bases a c g t c t g what would be the bases on the other strand?
tgcagac. A pairs with T and C Pairs with G.
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
