0
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
Wiki User
∙ 13y ago
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.
T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
Wiki User
∙ 13y ago
Wiki User
∙ 11y agoCTGGATCAATTC
Add your answer:
Earn +20 pts
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
In DNA, A binds to T and C binds to G Therefore the complementary DNA sequence to 5'-GAT-CGG-TAC-AGT-G-3' is: 3'-CTA-GCC-ATG-TCA-C-5'
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is the DNA code for A-T-C-G-A?
C-G-A-T-T-A-G-G-C
What is the name given to the process where the DNA is copied?
DNA Replication. A C T A G G T G A T C C A C T A G G T G A T C C
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
What is the structure of the DNA loop?
A to T, T to A, G to C, C to G
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
In DNA strands, C pairs with G and A pairs with T. The complementary strand to C-C-A-T-C-G would be G-G-T-A-C.
Which DNA strand can base pair with a-t-g-c-t-a?
T-A-C-G-A-T
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
t c c g a g t c a g a t c g
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
In DNA, A binds to T and C binds to G Therefore the complementary DNA sequence to 5'-GAT-CGG-TAC-AGT-G-3' is: 3'-CTA-GCC-ATG-TCA-C-5'
What is Compliment of c t a g c?
On the complementary side of the DNA, it would be G A T C G
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
