0
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
Wiki User
∙ 9y ago
It's GTTCATCCGA
Wiki User
∙ 10y ago
Add your answer:
Earn +20 pts
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What nucleotide sequence would be found on the partner DNA strand of the strand shown ACTGT?
The complementary (partner) strand to the segment ACTGT would be TGACA. This is because in DNA, A binds to T and C binds to G.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What would be the base sequence of the complementary mRNA strand?
TGCA
What complementary strand to the DNA sequence TAGTCA is?
The DNA base pairing rules are A-T and C-G, so the complementary strand to TAGTCA is ATCAGT.
A strand of dna contains the base sequence AGTTwhat is the sequence of the complementary strand of DNA?
tcaa --remember a attracts t while c attracts g
If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?
It would be T-A-A-G-C-C
What is the complementary strand of DNA?
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
Complementary dna sequence?
A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.
What sequence of bases would be complementary to A-G-C-T-A?
DNA:T-C-G-A-TmRNA:U-C-G-A-UmRNA rule: switch T with U_________________________________________Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.Therefore, if the template DNA strand were T-C-G-A-T, then:The complementary DNA strand would be A-G-C-T-AThe complementary RNA strand would be A-G-C-U-A
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
A strand of DNA contains the base sequence AGTT. What is the sequence of the complementary strand of DNA?
It is wrong. The corresponding DNA strand is: 5' tgc gtg act 3' because you have to do the complementary and then revert it.
What does it mean to say DNA polymerase reads a template strand to make the complementary strand?
During DNA replication, the enzyme DNA polymerase catalyses the formation of new strands of DNA, using the old strands as models. DNA has a double-helix structure, with two strands forming each helix. Each strand is made up of DNA nucleotides, with the genetic information encoded in the sequence of different nucleotides (different nucleotides are distinguished by molecules called 'bases' attached to them, so the sequence of nucleotides is known as the 'base sequence'). The base sequence of one strand is complementary to that of its' neighbour - the base A binds with T, and C with G, so if one strand had the sequence ATTACA, the base sequence of the complementary strand would be TAATGT. When DNA polymerase creates a new DNA strand, it does so by matching nucleotides to the base sequence of one of the strands - the template strand. New nucleotides are brought in, which match the template in a complementary fashion (ie. A-T, C-G), and join to become one new strand. This new strand is complementary to the template.
