0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
How do you Spell C T Scan?
*C T Scan is spelled just as you have done . {*X-ray computed tomography}
How do you program a 2000 Chrysler T and C van keyless entry remote?
With a factory scan tool.
What is the Nursing diagnosis of hydatidiform mole?
Acute pain r/t disease process Hyperthermia r/t increased metabolic rate secondary to illness Impaired physical mobility r/t muscle weakness hope it would help you.. lexy c",)
How much a new Single Slice C T Scan Machine will cost in India?
5 lakhs rupees
How does nucleic acid sequencing help in molecular diagnosis?
To really understand this process, consider the idea that nucleic acid combinations are like keys, and diagnoses are like locks. When you arrange the different acids (A, C, T, U), you are essentially creating a new key. This tells the body that THAT key will fit in THIS lock, meaning that the diagnosis will then fit the conditions of the lock. The sequences match up to the conditions of the diagnosis.
Can you help me unscramble the word s a you t a c i q?
Aquatics
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is a complementary DNA strand using a t t g c c a g c?
t a a c g g t c g
What is studyisland?
a test to help kids on the c r c t you are right but it a test hard to know in cst
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
t-t-a-c-g-g-t-a-g-c-t-t is the complementary strand. Adenine joins with Thymine (with two hydrogen bonds) and Cytosine joins with Guanine (with three hydrogen bonds)
Can you help me unscramble this word o t l i n c a r?
Cilantro
