answersLogoWhite

0


Best Answer

DNA:
T-C-G-A-T

mRNA:
U-C-G-A-U

mRNA rule: switch T with U
_________________________________________
Although the above answer is correct in that there are no thymines (T) in RNA, I must disagree with the rest of the answer. The mRNA strand given in the answer above would be the identical strand made from RNA, not the complementary strand as the question asked for.
A complementary strand is produced by an RNA or DNA polymerase from a template DNA strand.

Therefore, if the template DNA strand were T-C-G-A-T, then:

The complementary DNA strand would be A-G-C-T-A
The complementary RNA strand would be A-G-C-U-A

User Avatar

Wiki User

14y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

14y ago

The sequence of bases complementary of the strand would be:

C C G T C A A G T A C G.

This answer is:
User Avatar

User Avatar

Wiki User

11y ago

DNA: AGTGCAT

mRNA: AGUGCAU

This answer is:
User Avatar

User Avatar

Wiki User

14y ago

A-G-T-T-C-G

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What sequence of bases would be complementary to A-G-C-T-A?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


What would be the base sequence of the complementary mRNA strand?

TGCA


What be would the complementary strand of DNA for the following sequence of bases?

lol i hate this question........its in meh science book


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


How would the bases of the complementary strand read?

The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C


A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?

TGCA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


What is the complementary base sequence of cagttagc-oh?

A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.


What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?

The sequence would be GACGGT


What is the relationship between codons and anticodons?

A codon is found in the DNA sequence and in the mRNA sequence. The anticodon is the opposite sequence that would match with the sequence of the codon and allows pairing of the anticodon with the codon


What is the sequence of the complementary DNA strand gaattcggca?

Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer