0
What order of nitrogen bases would be in the matching lagging strand?
Wiki User
∙ 9y agoWant this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?
DNA Ligase, RNA primers, and Okazaki Fragments.
What part of nucleotide contains the genetic code?
strand of DNA
What rungs of DNA ladder made up of?
The rungs of DNA are made up of the nitrogenous bases Adenine (A), Cytosine (C), Guanine (G) and Thymine (T). Each rung represents the bonding of two bases (one from each DNA strand). A binds with T and C binds with G.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What are the four nitrogen bases present and DNA and how do they pair up?
The four bases are Guanine, Adenine, Thymine, and Cytosine--usually abbreviated as G, A, T, and C. In a DNA strand, A pairs with T and G with C.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
What is replicating the lagging strand of DNA that is adding bases in the 3-5 direction utilizes what?
DNA Ligase, RNA primers, and Okazaki Fragments.
How do the nitrogen bases pair up during replication?
By forming matching hydrogen bonds.
What bases would match up to form a matching DNA strand from this pattern?
THYMINE-ADENINE CYTOSINE-GUANINE
Two of the four nitrogen bases linked together in each double strand of DNA?
RNA
What is the name of the enzyme that places the corresponding nitrogen bases on the new strand of DNA?
t know for sure idkgdkjnkgdfsgd
What part of nucleotide contains the genetic code?
strand of DNA
What are the bases on the complimentary strand of bases for strand with the bases AAGCCA?
TTCGGT
How does the pairing of the nitrogen bases in DNA molecule make sure that a replicated strand is exactly the same as the original strand?
The complimentary pairing of the two strands of DNA with their nitrogen-containing bases allows them to make exact copies. Each one matches up with another exactly to make the "blue print" of the cell.
If the sequence of bases in one strand C-A-A-G-T what is the sequence of bases on the matching strand?
the complimentary styrand would be: T-C-C-G-A-T
What rungs of DNA ladder made up of?
The rungs of DNA are made up of the nitrogenous bases Adenine (A), Cytosine (C), Guanine (G) and Thymine (T). Each rung represents the bonding of two bases (one from each DNA strand). A binds with T and C binds with G.
Hydrogen bonds are found in DNA?
yes, hydrogen bonds are what connects the double helix together. hydrogen bonds for between the nitrogen bases on each DNA strand. nitrogen bases are: - Cytosine (C) - Thymine (T) - Guanine (G) - Adenins (A)
