0
What strand of DNA would be produced from the template strand AAC CT?
Wiki User
∙ 11y ago
Ttg ga
Marvin Schuster
Wiki User
∙ 10y agoTtg ga
Wiki User
∙ 11y agoA binds with T, and C binds with G.
Meaning the strand of DNA produced from the template AACCT would be TTGGA.
Wiki User
∙ 11y agoTtg ag
Wiki User
∙ 11y agoTtg ga
Wiki User
∙ 6y agoTtg ga
Anonymous
TTG GA
Add your answer:
Earn +20 pts
What strand of DNA would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
AAC would bind with what anticodon?
UUGCodon-AnticodonA - UT - AC - GG - C
How might one missing nucleotide or the insertion of one additional nucleotide in a DNA strand alter the formation of the translated protein?
Deletion of just one nucleotide in a protein-coding part of a gene will cause a "frameshift mutation." Since the nucleotides are read in groups of three (codons) along the gene, the groupings will change and the protein that results is likely to be completely different.
What strand of DNA of would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
What strand of DNA would be produced from the template strand of DNA?
AAC CT would produce TTG GA The coding strand is the DNA strand that has the same base sequence as the RNA transcript. It contains codons, and the non-coding strand has anti-codons instead.
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
What is the complementary strand of DNA to catttggga?
Gta aac cct
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What would the complementary mRNA strand be for this gene tac ttg cta act?
AUG AAC GAU UGA Please specificy 5' 3' end for more clarity
A DNA strand with the sequence AAC GTA ACG what is the sequence of the mRNA molecule synthesized?
UUG CAU UGC
If the nucleotide or base sequence of the DNA strand used as a template for messanger RNA synthsis is ACGTT then the sequence of bases in the correspnding mRNA would be?
For a DNA strand having the code, "aac tae ggt" the corresponding rna strand would be: "UUG AU? CCA". There is no "e" pyridine, so I do not know what would pair with "e." In DNA, the purines are Adenine and Guanine, and the pairing pyrimidines are Cytosine and Thymine, respectively. Thus, in DNA, A pairs with T and G pairs with C. In rna, the pyrimidines are again Adenine and Guanine, but the pairing pyrimidines are Uracil and Cytosine respectively. In rna, A pairs with U and G pairs with C
What is the complimentary strand of 5' ACCCGAAATTTG 3'?
A binds with T, G binds with C and the two strands are anti-parallel (run in different directions).Therefore the complementary strand for 5' TAC GAT 3' is 3' ATG CTA 5'
Does android support aac?
Considering that you are talking about media player format i.e. .aac I would what supports such file format are media player. So, media player over Android supports .aac format.
What would be the sequence of the complimentary DNA strand for this gene atc gtt aac gca?
The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.
What is aac format?
an aac format is an... acc format :)
