answersLogoWhite

0

there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.

User Avatar

Wiki User

∙ 16y ago

What else can I help you with?

Related Questions

Does the prion protein contain a signal sequence?

Yes, the prion protein does not contain a signal sequence. It is primarily localized to the cell membrane without the need for a signal sequence to direct its insertion.


What is the effects of mutation?

A mutation is a permenent in DNA sequence of a gene,mutation in a gene's DNA sequence can alterthe aminoacid sequence of the protein encodedby the gene.


What feature in a cell containthe DNA sequence to make a specific protein?

gene


What is the relationship between a cognate protein and its corresponding gene in the process of protein synthesis?

A cognate protein is a protein that is produced by a gene with a matching sequence. In the process of protein synthesis, the gene serves as a template for the production of the cognate protein through transcription and translation. The gene provides the instructions for the sequence of amino acids that make up the protein, which is then synthesized by the cell.


What is the specific expressed sequence of DNA that codes for a protein in this genetic sequence?

The specific expressed sequence of DNA that codes for a protein in this genetic sequence is called a gene.


What parts of a chromosome specify the amino acid sequence of a protein?

The gene within a chromosome contains the specific sequence of nucleotides that codes for the amino acid sequence of a protein. This gene is transcribed into messenger RNA (mRNA), which is then translated into a specific sequence of amino acids during protein synthesis.


What is the entire sequence of DNA bases responsible for the manufacture of a protein or part of a protein is called a?

The entire sequence of DNA bases responsible for the manufacture of a protein or part of a protein is called a gene. Genes contain the instructions for making proteins through a process called protein synthesis, involving transcription and translation. Each gene has a specific sequence of nucleotide bases that encodes the information for a particular protein.


Is a prion a protein?

Yes, a prion is a type of protein that can cause infectious diseases in animals and humans.


What is gene expression-?

Gene expression is the process by which the information encoded in a gene is used to direct the assembly of a protein molecule. The cell reads the sequence of the gene in groups of three bases. Each group of three bases (codon) corresponds to one of 20 different amino acids used to build the protein.


What you would find in a gene?

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).


Name for a sequence of DNA bases that code for one protein?

Name for a sequence of DNA bases that code for one protein?


What are the ordered base pairs along a gene called?

Guanine and Cytosine, and Thymine and Adenine.