0
there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
What is a sequence in DNA that codes for a protein and thus determines a trait?
A gene is a DNA sequence that codes for a protein.
What is the effects of mutation?
A mutation is a permenent in DNA sequence of a gene,mutation in a gene's DNA sequence can alterthe aminoacid sequence of the protein encodedby the gene.
Discuss diagram the process from gene to protein In other words how do you build a protein based on a sequence of DNA?
Discuss/diagram the process from gene to protein. In other words, how do we build a protein based on a sequence of DNA?
How is find the gene sequence of an monoclonal antibody found?
find the protein sequence in protein sequence data base.....then from the protein sequence u can find the antibody gene sequence...... u can also go for nucleotide sequencing....which will directly help u in getting the sequence.....u can check this in bioinformatics data base
What feature in a cell containthe DNA sequence to make a specific protein?
gene
Which of these is an infectious protein viroid vector virus prion?
Prion
What is gene expression-?
Gene expression is the process by which the information encoded in a gene is used to direct the assembly of a protein molecule. The cell reads the sequence of the gene in groups of three bases. Each group of three bases (codon) corresponds to one of 20 different amino acids used to build the protein.
What is the entire sequence of DNA bases responsible for the manufacture of a protein or part of a protein is called a?
gene
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
Does gene indicate sequence of amino acids of protein molecule?
YES
What is a chromosomal mutation?
mutation is a permanent change in the DNA sequence of a gene and can alter the amino acid sequence of the protein encoded by the gene..
How is it possible for a point mutation to have no effect on the function of gene?
If the point mutation does not change the protein to be translated in the 3-letter sequence, then it will have no effect on the gene's function.
