0
They direct a specific Restriction Enzyme to cut the Dna Exactly where required.
Wiki User
∙ 11y ago
Add your answer:
Earn +20 pts
Which enzyme would cut for this strand of DNA gcatggatcccaatgc?
gcgtagg
How do you calculate the GC content in a DNA strand?
Very Carefully
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
Which dna strand is complementary to cga atc agc?
Gct tag tcg
Explain how DNA replication takes place?
An enzyme unzips a DNA stand and a separate strand without base pairs come sup and matches it with the proper ones (A-U)( C-G) making RNA which goes to a ribosome outside the nucleus, makes a protein, makes a new strand of DNA and the other strand re zips with the new DNA strand.
Which enzyme would cut for this strand of DNA gcatggatcccaatgc?
gcgtagg
How many strands of DNA are there in a DNA fingerprint?
1 strand of naked genomic DNA cut by certain enzymes.
What is the strand?
The template strand, if reffering to DNA, is the strand of the DNA that is copied to make more DNA.
A restriction enzyme is likely to cut which kind of molecules?
DNA molecules. A strand of DNA molecules can be cut to have blunted ends or jagged ends (sticky ends).
DNA from two different organisms that has been cut up and recombined so that the resulting strand contains DNA from both organisms is refereed to as?
Recombinant DNA.
Name of the DNA strand which is copied to make mRNA?
This is typically called the template DNA, which is the anti-sense strand of DNA. The strand that is not transcribed is called the sense strand.
What is the role of the DNA new strand?
It is a copy of the Dna original strand.
What would match the DNA strand TCCGAACGTC?
The DNA strand, AGGCTTGCAG.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
What is the complementary DNA strand template strand of atgccatgg?
The complementary DNA strand template of ATGCCATGG is the basic design structure. It determines how the DNA strand will be constructed and the process in which it is formed.
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
CCAATTG
